Unlock instant, AI-driven research and patent intelligence for your innovation.

Pichia pastoris strain capable of producing high-yield alpha-galactosidase

A technology of galactosidase and Pichia pastoris, which is applied in the field of Pichia pastoris engineering strains with high α-galactosidase production, can solve the problem of high price, few kinds of α-galactosidase products, and wide range of restriction enzymes. application and other issues to achieve the effect of reducing production costs and promoting promotion and application

Active Publication Date: 2018-11-20
WEIFANG KANGDIEN BIOTECH +1
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there are relatively few types of α-galactosidase products on the market, and due to the low yield of the production strains, the price of the enzyme remains high, which seriously limits the wide application of the enzyme in feed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pichia pastoris strain capable of producing high-yield alpha-galactosidase
  • Pichia pastoris strain capable of producing high-yield alpha-galactosidase
  • Pichia pastoris strain capable of producing high-yield alpha-galactosidase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] The construction of embodiment 1 recombinant plasmid

[0017] Using Aspergillus niger (Aspergillus niger) Su genome as a template, using primer 1 and primer 2 to amplify the α-galactosidase gene fragment, its nucleotide sequence (removing introns) is SEQ ID NO: 2, which encodes The amino acid sequence of is SEQ ID NO:1.

[0018] PCR primers and reaction conditions are as follows:

[0019] Primer 1 (F): GCTCCCGCAGTTGGGGCTTCA

[0020] Primer 2 (R): TTATTGCCGCTCCAGAAAGAC

[0021] The reaction conditions were: denaturation at 94°C for 5 minutes; then denaturation at 94°C for 30 s, renaturation at 56°C for 30 s, extension at 72°C for 120 s, and after 30 cycles, incubation at 72°C for 10 min. The results of agarose electrophoresis showed that the size of the amplified α-galactosidase gene was 2178bp.

[0022] The α-galactosidase gene was digested with restriction endonucleases EcoR I and Not I (Fermentas); meanwhile, the plasmid pPIC9K was digested with restriction endonu...

Embodiment 2

[0024] The construction of embodiment 2 Pichia pastoris engineering strain

[0025] The recombinant plasmid pPIC9K-AG was linearized with Sal I, and the linearized plasmid fragment was transformed into the host cell Pichia pastoris (Pichia pastoris) GS115 by electroporation, and the Pichia pastoris recombinant strain GS115 / pPIC9K-AG was obtained by screening on the MD plate. Multi-copy transformants were then screened on YPD plates containing different concentrations of geneticin.

[0026] Pick a single transformant and transfer it to BMGY medium, shake culture at 30°C 250rpm for 1 day, then transfer to BMM medium 30°C 250rpm shake culture, add 0.5% methanol every day; after inducing expression for 4 days, remove the cells by centrifugation , to obtain the fermentation supernatant containing α-galactosidase; the fermentation supernatant was subjected to SDS-PAGE electrophoresis detection and enzyme activity detection respectively. The results showed that the molecular weight ...

Embodiment 3

[0034] The mutagenesis screening of embodiment 3 Pichia pastoris engineering strain AG

[0035] The mutations caused by ultraviolet mutagenesis are very random, and the effects of mutations are also random and difficult to predict. Therefore, in order to obtain effective positive mutations, technicians usually need to carry out multiple rounds of ultraviolet mutagenesis, the workload of screening is relatively large, and there is a possibility that effective positive mutations cannot be obtained. However, because ultraviolet mutagenesis requires simple equipment, low cost, and a large number of mutants can be obtained in a short period of time, it is still a commonly used method of mutagenesis selection.

[0036] The applicant used Pichia pastoris AG as the starting strain, and carried out genetic modification on it by means of ultraviolet mutagenesis to further increase the production of α-galactosidase.

[0037] Inoculate the starting strain Pichia AG on a YPD plate, culture ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a pichia pastoris mutant strain, wherein the preservation number is CCTCC NO: M2018376. The mutant strain perform efficient recombinant expression on alpha-galactosidase, theenzyme activity of alpha-galactosidase in supernatant fermented by shaking a flask is up to 109 U / mL and is137 percent higher than that of the original strain; the enzyme activity of alpha-galactosidase in supernatant fermented by a 20-L tank is up to 7576 U / mL and is 69 percent higher than that of the original strain and the unexpected technical effect is achieved. Furthermore, compared with theoriginal strain, the enzymatic property of the alpha-galactosidase which is subjected to recombinant expression by the mutant strain pichia pastoris AG2 is not changed, the pH of the moist proper effect is 3 to 7, and the temperature of the most proper effect is 60 DEG C. The mutant strain pichia pastoris AG2 can be widely applied to production of the alpha-galactosidase.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a Pichia pastoris engineering strain with high alpha-galactosidase production and application thereof. Background technique [0002] α-galactosidase (α-galactosidase) is an exoglycosidase that catalyzes the hydrolysis of α-galactosidic bonds, because it can decompose melibiose, also known as melibiose, it can catalyze Hydrolysis of bonds. The catalysis of α-galactosidase is to remove the α-linked non-reducing D-galactose at the end of the substrate, or to transfer the galactose group to the acceptor by α-1,6 glycosidic bond through transglycosylation on the hydroxyl group at the C6 position. Substrates and acceptors containing this type of glycosidic bonds are widely distributed in nature. Therefore, α-galactosidase has a wide range of applications in industry, food, medical and scientific research, and is considered to be the most potential enzyme. One...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N9/40C12N15/56C12R1/84
CPCC12N9/2465C12N15/815C12Y302/01022
Inventor 徐晓东赵凯黄亦钧
Owner WEIFANG KANGDIEN BIOTECH