Pichia pastoris strain capable of producing high-yield alpha-galactosidase
A technology of galactosidase and Pichia pastoris, which is applied in the field of Pichia pastoris engineering strains with high α-galactosidase production, can solve the problem of high price, few kinds of α-galactosidase products, and wide range of restriction enzymes. application and other issues to achieve the effect of reducing production costs and promoting promotion and application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] The construction of embodiment 1 recombinant plasmid
[0017] Using Aspergillus niger (Aspergillus niger) Su genome as a template, using primer 1 and primer 2 to amplify the α-galactosidase gene fragment, its nucleotide sequence (removing introns) is SEQ ID NO: 2, which encodes The amino acid sequence of is SEQ ID NO:1.
[0018] PCR primers and reaction conditions are as follows:
[0019] Primer 1 (F): GCTCCCGCAGTTGGGGCTTCA
[0020] Primer 2 (R): TTATTGCCGCTCCAGAAAGAC
[0021] The reaction conditions were: denaturation at 94°C for 5 minutes; then denaturation at 94°C for 30 s, renaturation at 56°C for 30 s, extension at 72°C for 120 s, and after 30 cycles, incubation at 72°C for 10 min. The results of agarose electrophoresis showed that the size of the amplified α-galactosidase gene was 2178bp.
[0022] The α-galactosidase gene was digested with restriction endonucleases EcoR I and Not I (Fermentas); meanwhile, the plasmid pPIC9K was digested with restriction endonu...
Embodiment 2
[0024] The construction of embodiment 2 Pichia pastoris engineering strain
[0025] The recombinant plasmid pPIC9K-AG was linearized with Sal I, and the linearized plasmid fragment was transformed into the host cell Pichia pastoris (Pichia pastoris) GS115 by electroporation, and the Pichia pastoris recombinant strain GS115 / pPIC9K-AG was obtained by screening on the MD plate. Multi-copy transformants were then screened on YPD plates containing different concentrations of geneticin.
[0026] Pick a single transformant and transfer it to BMGY medium, shake culture at 30°C 250rpm for 1 day, then transfer to BMM medium 30°C 250rpm shake culture, add 0.5% methanol every day; after inducing expression for 4 days, remove the cells by centrifugation , to obtain the fermentation supernatant containing α-galactosidase; the fermentation supernatant was subjected to SDS-PAGE electrophoresis detection and enzyme activity detection respectively. The results showed that the molecular weight ...
Embodiment 3
[0034] The mutagenesis screening of embodiment 3 Pichia pastoris engineering strain AG
[0035] The mutations caused by ultraviolet mutagenesis are very random, and the effects of mutations are also random and difficult to predict. Therefore, in order to obtain effective positive mutations, technicians usually need to carry out multiple rounds of ultraviolet mutagenesis, the workload of screening is relatively large, and there is a possibility that effective positive mutations cannot be obtained. However, because ultraviolet mutagenesis requires simple equipment, low cost, and a large number of mutants can be obtained in a short period of time, it is still a commonly used method of mutagenesis selection.
[0036] The applicant used Pichia pastoris AG as the starting strain, and carried out genetic modification on it by means of ultraviolet mutagenesis to further increase the production of α-galactosidase.
[0037] Inoculate the starting strain Pichia AG on a YPD plate, culture ...
PUM
Property | Measurement | Unit |
---|---|---|
Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com