Supercharge Your Innovation With Domain-Expert AI Agents!

Preparation method of transgenic chicken oviduct bioreactor

A bioreactor, transgenic chicken technology, applied in the field of genetic engineering, can solve problems such as double-strand mutation, and achieve the effects of simple operation, overcoming uncertainty, low efficiency, and high efficiency

Active Publication Date: 2018-12-21
上海索境生物科技有限公司 +1
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Homologous recombination repair can only occur when the same sequence at both ends of the broken DNA exists in the cell. After constructing a homologous sequence at both ends of the target DSB at both ends of the exogenous DNA, the genomic DNA can be inserted losslessly through homologous recombination repair; when the cell There is no template with the same sequence in the DNA, and the DNA double strands are repaired by non-homologous end joining, but the result will cause different degrees of mutations in the joined double strands

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of transgenic chicken oviduct bioreactor
  • Preparation method of transgenic chicken oviduct bioreactor
  • Preparation method of transgenic chicken oviduct bioreactor

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0033] A kind of preparation method of transgenic chicken oviduct bioreactor of the present invention comprises the following steps:

[0034] S1. Design gRNA targeting chicken genomic DNA: the selected chicken genome target DNA sequence is the first intron of ovalbumin, the sequence is shown in SEQ.1, according to the different PAM sequence rules of different types of Cas9 proteins, select homology More than 90% gRNA;

[0035] 5'-CTCAAAAGGTAAGCAACTCTCTGGAATTACCTTCTCTCTATATTAGCTCTTACTTGCACCTAAACTTTAAAAAATTAACAATTATTGTGTTATGTGTTGTATCTTTAAGGGTGAAGTACCTGCGTGATACCCCCTATAAAAACTTCTCACCTGTGTATGCATTCTGCACTATTTTATTATGTGTAAAAGCTTTGTGTTTGTTTTCAGGAGGCTTATTCTTTGTGCTTAAAATATGTTTTTAATTTCAGAACATCTTATCCTGTCGTTCACTATCTGATATGCTTTGCAGTTTGCCTGATTAACTTCTAGCCCTACAGAGTGCACAGAGAGCAAAATCATGGTGTTCAGTGAATTCTGGGGAGTTATTTTAATGTGAAAATTCTCTAGAAGTTTAATTCCTGCAAAGTGCAGCTGCTGATCACTACACAAGATAAAAATGTGGGGGGTGCATAAACGTATATTCTTACAATAATAGATACATGTGAACTTGTATACAGAAAAGAAAATGAGAAAAATGTGTGTGCGTATACTCACACACGTGGTCAGTAAAAACTTTTG...

Embodiment 1

[0047] When the PAM type is 5'-NNN-3', SpCas9 derived from Streptococcus pyogenes is commonly used. The PAM rule is 5'-NGG-3'. SpCas9 generates 65 target site sequences in the target DNA sequence, as shown in Table 1. .

[0048] Table 1 The target site sequence of SpCas9 in the target DNA sequence

[0049]

[0050]

[0051] With the sequence TGTGCGTATACTCACACACG TGG For example, where TGG is the PAM sequence, and TGTGCGTATACTCACACACG is the target site sequence.

[0052](1) Use the pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid as a vector (Addgene plasma ID: 42230, hereinafter referred to as pX330), which can express gRNA and SpCas9 protein at the same time, digest 1ug pX330 plasmid with 1uL BbsI, and incubate at 37°C for 1 Hours later, 1% agarose electrophoresis was used to recover the digested fragment (QIAquick Gel Extraction Kit recovery kit), and the enzyme digestion reaction system was as follows:

[0053]

[0054] According to the selected target site sequence...

Embodiment 2

[0075] The human albumin gene was used as the exogenous gene to construct the donor plasmid.

[0076] 1. Construct a homologous repair donor plasmid. The homologous donor DNA is sequentially connected by the upstream homology arm, the exogenous gene expression frame and the downstream homology arm. The exogenous gene expression frame includes a first intron sequence to complete the first intron sequence of the ovalbumin gene. An intron sequence; human serum albumin ALB gene, the original signal peptide is removed, and chicken lysozyme signal peptide is added. A BGHpolyA sequence that protects the mRNA structure.

[0077] (1). Single-stranded DNA is used as the template for homologous recombination repair. The upstream 90bp of the genome break site is used as the upstream homology arm, and the downstream 90bp is used as the downstream homology arm. The antisense strand is used as the template for artificial synthesis. The schematic diagram of the operation is shown in the figu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a preparation method of a transgenic chicken oviduct bioreactor. The preparation method comprises the following steps: S1, designing gRNA of targeted genome DNA; S2, building anexpression carrier of the gRNA; S3, building a donor carrier carrying a foreign gene expression frame, wherein the donor carrier comprises a homologous repaired carrier and a non-homologous repairedcarrier; S4, importing the carrier into chicken. Through combination with a CRISPR gene editing technology, the accuracy in integrating the foreign gene into the genome is improved, efficient foreigngene importing is realized, transgenic chicken capable of expressing and secreting foreign proteins into egg white can be prepared, and stable heredity of the foreign gene to the descendant is realized.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a transgenic chicken oviduct bioreactor. Background technique [0002] Poultry fallopian tube bioreactor mainly refers to poultry mainly chickens, which express exogenous protein with medicinal value in the fallopian tube tissue and secrete it into the laid poultry eggs and then excrete it from the body. The types of exogenous proteins include various recombinant proteins that are currently on the market, such as insulin, monoclonal antibodies, etc. As early as 1994, Chinese scientist Zeng Jie (Zeng Bangzhe) proposed the concept of poultry oviduct bioreactor and the transgenic poultry golden egg project, and at the first national transgenic seminar in 1996, he cooperated with the United States, Canada, Japan, the United Kingdom, etc. The laboratory contacted the developer company, and then Avigenics of the United States and Professor R.Ivarie of the University of Geo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/85C12N15/90A01K67/027
CPCA01K67/0276A01K67/0278C12N15/113C12N15/8509C12N15/902A01K2207/15A01K2217/072A01K2217/075A01K2227/30A01K2267/01C12N2310/20C12N2310/10
Inventor 石铭
Owner 上海索境生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More