Check patentability & draft patents in minutes with Patsnap Eureka AI!

Recombinase-mediated amplification constant temperature detection method and kit of precious Chinese herbal medicine American ginseng

A detection method, the technology of American ginseng, which is applied in the direction of biochemical equipment and methods, and the measurement/inspection of microorganisms, can solve the problems of mixed fish and dragons in American ginseng, and achieve the effect of simple operation and simple identification

Active Publication Date: 2022-04-01
ZHEJIANG INST FOR FOOD & DRUG CONTROL +2
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Many people who have been operating American ginseng for a long time know that imported American ginseng has a lot of tricks.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinase-mediated amplification constant temperature detection method and kit of precious Chinese herbal medicine American ginseng
  • Recombinase-mediated amplification constant temperature detection method and kit of precious Chinese herbal medicine American ginseng
  • Recombinase-mediated amplification constant temperature detection method and kit of precious Chinese herbal medicine American ginseng

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Primer and probe design screening

[0029] In the present invention, the entire gene sequence of American ginseng is searched in the Genebank database, and DNAMAN 6.0 software is used to compare the multiple sequences to find out the conserved section. Three sets of primers and probes were designed in the conserved regions, and BLAST alignment was performed in the NCBI database. The sequences of the primers and probes are shown in Table 1.

[0030] For the positive plasmid of the gene sequence of the conserved region of American ginseng, the base sequence of the plasmid is amplified as shown in SEQ ID NO.

[0031] ATGGCCCATCACGCCCAACAGGTAAAAGGGGTGCATGGCATGCATGGA AATCTAGAAAGGTACCATCGCGTGAGCTAAGCCCCATCGTGTTGAGCAACC AAAATCCAACGCAAGGAGATAAATCTTGAGTCGAGGTTAACACGACCTTTT TTGTTTCATGTGTGAGGCGAAGAGGTCCACGGCCCGTAGCACGCCGTGGC AGGGCCCAACACGCCCAGAGGCAGCACCACGCACACGCAAACAGGCAAC GCCAACCAGGACCATCGAATGAAATGGCGGCAAACATGAAAAAAGCTTGC ACTACACCATTTCCTCGAGCTA(SEQ ID NO.4)

[0032...

Embodiment 2

[0044] Example 2: Kit assembly method

[0045] The kit American ginseng

[0046] The nucleic acid detection kit of the present invention further includes primer mixture, specific fluorescent probe, A Buffer, BBuffer, RAA dry powder reagent, American ginseng standard and ddH 2 O. In the kit of the present invention, the A Buffer is 20% PEG; the B Buffer is 280 mM MgAc. In the kit of the present invention, the components of the RAA dry powder reagent are as follows: 1mmol / L dNTP, 90ng / μL SSB protein, 120ng / μL recA recombinase protein (SC-recA / BS-recA) or 30ng / μL μL Rad51, 30ng / μL Bsu DNA polymerase, 100mmol / L Tricine, 20% PEG, 5mmol / L dithiothreitol, 100ng / μL creatine kinase, Exo exonuclease.

[0047] In the primer mixture of the present invention, the base sequence of the forward primer is shown in SEQ ID NO.1, the base sequence of the reverse primer is shown in SEQ ID NO.2, the forward primer and the reverse primer are shown in SEQ ID NO.2. The molar ratio of the prime...

Embodiment 3

[0048] Example 3: Kit application method

[0049] 1. Extraction of nucleic acid from positive samples

[0050] 1.1. Nucleic acid extraction: using CTAB modified method to extract plant genomic DNA nucleic acid.

[0051] ① Take the same tissue powder and add 700 μL of 2×CTAB extraction buffer preheated in a 65°C water bath, stir gently, put it in a 1.5ml sterilized centrifuge tube, and keep it in a 65°C water bath or incubator for 40 minutes , shake gently every 10min;

[0052] ②After cooling for 2min, add equal volume of chloroform:isoamyl alcohol (24:1) and mix well, centrifuge at 10000r / min for 10min, take the supernatant and transfer it to a 600μL isopropanol centrifuge tube;

[0053] ③ Shake gently for 30s until DNA flocs are visible;

[0054] ④ After centrifugation at 10,000 r / min for 1 min, immediately pour off the liquid to retain the white DNA precipitate. After standing upside down for 60 s, add 720 μL of 75% ethanol and 80 μL of 5M sodium acetate, and leave at r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides a method for detecting American ginseng species in traditional Chinese medicine ( Panax quinquefolius ) Recombinase-aid Amplification (RAA) constant temperature detection method and detection kit. The detection kit includes a forward primer of SEQ ID NO.1, a reverse primer of SEQ ID NO.2, a specific fluorescent probe of SEQ ID NO.3, a reaction solution, a recombinant polymerase and a control substance. The kit of the invention has strong specificity; high detection sensitivity, which can reach 0.10fg / μL; high accuracy and reliability; simple and quick operation, suitable for on-site detection, and has wide application scenarios.

Description

technical field [0001] The invention belongs to the field of precious fine Chinese herbal medicine detection and the technical field of molecular biology, in particular, to how to use recombinase-aid amplification (Recombinase-aid Amplification, RAA) constant temperature detection technology combined with specific primers and fluorescent probes to identify traditional Chinese medicines The method for whether or not it contains American ginseng (Panax quinquefolius) ingredients. Background technique [0002] Since 2017, my country's new policies on traditional Chinese medicine have been introduced intensively, especially the implementation of the "Traditional Chinese Medicine Law" and the release of the "Poverty Alleviation Action Plan for the Chinese Medicinal Materials Industry (2017-2020)", which has brought new opportunities for the development of the Chinese medicinal materials industry. In this context, the scale of the supply of Chinese medicinal materials across the c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/6844
CPCC12Q1/6844C12Q1/6895C12Q2521/507C12Q2522/101C12Q2563/107
Inventor 沈泓程奇王知坚蒋超鲍传正李超袁媛陈碧莲孙晗韩晓李文庭
Owner ZHEJIANG INST FOR FOOD & DRUG CONTROL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More