Recombinase-mediated amplification constant temperature detection method and kit of precious Chinese herbal medicine American ginseng
A detection method, the technology of American ginseng, which is applied in the direction of biochemical equipment and methods, and the measurement/inspection of microorganisms, can solve the problems of mixed fish and dragons in American ginseng, and achieve the effect of simple operation and simple identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1: Primer and probe design screening
[0029] In the present invention, the entire gene sequence of American ginseng is searched in the Genebank database, and DNAMAN 6.0 software is used to compare the multiple sequences to find out the conserved section. Three sets of primers and probes were designed in the conserved regions, and BLAST alignment was performed in the NCBI database. The sequences of the primers and probes are shown in Table 1.
[0030] For the positive plasmid of the gene sequence of the conserved region of American ginseng, the base sequence of the plasmid is amplified as shown in SEQ ID NO.
[0031] ATGGCCCATCACGCCCAACAGGTAAAAGGGGTGCATGGCATGCATGGA AATCTAGAAAGGTACCATCGCGTGAGCTAAGCCCCATCGTGTTGAGCAACC AAAATCCAACGCAAGGAGATAAATCTTGAGTCGAGGTTAACACGACCTTTT TTGTTTCATGTGTGAGGCGAAGAGGTCCACGGCCCGTAGCACGCCGTGGC AGGGCCCAACACGCCCAGAGGCAGCACCACGCACACGCAAACAGGCAAC GCCAACCAGGACCATCGAATGAAATGGCGGCAAACATGAAAAAAGCTTGC ACTACACCATTTCCTCGAGCTA(SEQ ID NO.4)
[0032...
Embodiment 2
[0044] Example 2: Kit assembly method
[0045] The kit American ginseng
[0046] The nucleic acid detection kit of the present invention further includes primer mixture, specific fluorescent probe, A Buffer, BBuffer, RAA dry powder reagent, American ginseng standard and ddH 2 O. In the kit of the present invention, the A Buffer is 20% PEG; the B Buffer is 280 mM MgAc. In the kit of the present invention, the components of the RAA dry powder reagent are as follows: 1mmol / L dNTP, 90ng / μL SSB protein, 120ng / μL recA recombinase protein (SC-recA / BS-recA) or 30ng / μL μL Rad51, 30ng / μL Bsu DNA polymerase, 100mmol / L Tricine, 20% PEG, 5mmol / L dithiothreitol, 100ng / μL creatine kinase, Exo exonuclease.
[0047] In the primer mixture of the present invention, the base sequence of the forward primer is shown in SEQ ID NO.1, the base sequence of the reverse primer is shown in SEQ ID NO.2, the forward primer and the reverse primer are shown in SEQ ID NO.2. The molar ratio of the prime...
Embodiment 3
[0048] Example 3: Kit application method
[0049] 1. Extraction of nucleic acid from positive samples
[0050] 1.1. Nucleic acid extraction: using CTAB modified method to extract plant genomic DNA nucleic acid.
[0051] ① Take the same tissue powder and add 700 μL of 2×CTAB extraction buffer preheated in a 65°C water bath, stir gently, put it in a 1.5ml sterilized centrifuge tube, and keep it in a 65°C water bath or incubator for 40 minutes , shake gently every 10min;
[0052] ②After cooling for 2min, add equal volume of chloroform:isoamyl alcohol (24:1) and mix well, centrifuge at 10000r / min for 10min, take the supernatant and transfer it to a 600μL isopropanol centrifuge tube;
[0053] ③ Shake gently for 30s until DNA flocs are visible;
[0054] ④ After centrifugation at 10,000 r / min for 1 min, immediately pour off the liquid to retain the white DNA precipitate. After standing upside down for 60 s, add 720 μL of 75% ethanol and 80 μL of 5M sodium acetate, and leave at r...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap