Preparation method and application of engineering bacteria for efficiently expressing growth hormone

A growth hormone and high-efficiency expression technology, applied in the field of genetic engineering, can solve the problems of poor formation of disulfide bonds, easy degradation of recombinant proteins, low secretion efficiency, etc., to facilitate protein purification, avoid inclusion bodies or precipitation, and have Beneficial for purification

Inactive Publication Date: 2019-03-01
湖南百尔泰克生物科技有限公司
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional expression of recombinant hGH by Escherichia coli has two different technical approaches. One is to produce intracellular recombinant human growth hormone. Although the intracellular expression is relatively high, the purification is troublesome. In addition, the recombinant protein is easy to degrade. And it cannot form disulfide bonds well; the other is to produce secreted recombinant human growth hormone, the purification steps are simple, the interference of foreign proteins is less, and the oxidized environment is conducive to the formation of disulfide bonds, but usually its secretion efficiency is not high , most of the expressed protein may remain in the cell

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of engineering bacteria for efficiently expressing growth hormone
  • Preparation method and application of engineering bacteria for efficiently expressing growth hormone
  • Preparation method and application of engineering bacteria for efficiently expressing growth hormone

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] 1) HG16122-CF (http: / / www.sinobiologicalcdn.com / reagent / HG16122-CF.pdf) was used as the template plasmid (shown in SEQ ID NO: 1), and the upstream primer 1 containing the HRV3C protease cleavage site and Containing PST1 restriction endonuclease restriction site downstream primer 2, the hGH gene is amplified by PCR, after purification, the amplified hGH gene is obtained, wherein:

[0023] The upstream primer 1 is: CTGGAAGTCCTGTTTCAGGGACCCTTCCCAACCATTCCCTTATCCAG (shown in SEQ ID NO: 2);

[0024] Downstream primer 2 is: CGGCCAGTGCCAAGCTTGCCTGCAGCTAGAAGCCACAGCTGCCCTCC (shown in SEQ ID NO: 3);

[0025] The KOD FX PCR reaction system is: 94°C for 2min, 98°C for 10sec, 62°C for 30Sec, 68°C for 50sec, repeated for 35 cycles; 68°C for 5min; 4°C hold.

[0026] 2) Using the upstream primer 1 of the reverse complementary sequence of the homologous arm of the PST1 restriction site and the downstream primer 2 of the reverse complementary sequence containing the HRV3C protease cleava...

Embodiment 3

[0042] Small amount of expression of the recombinant genetically engineered bacteria in Example 1 and Comparative Example 1:

[0043] The recombinant genetically engineered bacteria 1 and 2 were subjected to the following treatments respectively:

[0044] 1) The selected monoclonal strains were inoculated into 5 ml ampicillin-resistant TB liquid medium, and cultured at 37° C. for 24 hours.

[0045] 2) The next day, take 1ml of the bacterial solution and transfer it to 100ml of TB liquid medium, and culture the bacteria to OD at 37°C 600 When =0.7-0.9, add IPTG to a final concentration of 0.2mM, and induce expression at 18°C ​​for 16h.

[0046] 3) Take 100 μl of bacterial liquid and directly add 30 μl of SDS loading buffer, and heat at 95° C. for 20 minutes. Then take out 10 μl for SDS-page electrophoresis to detect the expression of hGH;

[0047] 4) The remaining bacterial liquid was centrifuged at 6000 rpm for 20 minutes to collect bacterial precipitates.

[0048] 5) Coll...

Embodiment 4

[0052] Example 4: Massive expression of hGH protein

[0053] 1) Inoculate 10 ml of TB liquid medium with the engineering bacteria 1 in Example 1, and incubate at 37° C. for 24 hours.

[0054] 2) The next day, transfer 10ml of the bacterial solution to 1L of TB liquid medium, and continue to grow the bacteria to OD at 37°C 600 =0.7-0.9, add IPTG to its final concentration of 0.2mM, induce expression at 18°C ​​for 16h, and collect the bacteria.

[0055] 3) Resuspend the collected bacteria with 100ml of hypertonic solution (buffer I: 30mM Tris, 20% W / V sucrose, 1mM EDTA), and after stirring at 4°C for 30min, centrifuge at 8000g for 20min, discard the supernatant, and then Use 100ml hypotonic solution (buffer II: 5mM MgSO 4 ) to resuspend the cells, stir at 4°C for 10-30min, centrifuge again at 8000g for 20min, and collect the hypotonic supernatant.

[0056] 4) Take 2ml of dextrin ligand affinity chromatography medium and put it into a gravity column, wash with binding buffer (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a preparation method of engineering bacteria for efficiently expressing growth hormone. The preparation method comprises the following steps: 1) amplifying human growth hormonehGH gene by a PCR method to obtain an amplified hGH gene; 2) connecting the amplified hGH gene in step 1) to a pMal-p2x vector to obtain recombinant plasmids pMal-hGH; 4) guiding the recombinant plasmids in step 3) into escherichia coli BL21 (DE3), inducing protein expression by IPTG, and after it determines that expression is correct, obtaining the engineering bacteria for efficiently expressingthe growth hormone. The pMal-p2x is taken as vectors separately to obtain recombinant plasmids pMal-p2x-GH, an amino terminal of the recombinant plasmids of pMal-p2x-GH is provided with an MBP protein tag, therefore, the recombinant plasmids are guided into a receptor of the escherichia coli, hGH and MBP tags can be subjected to fusion expression, therefore, hGH is brought to a peripheral mass space, purification of hGH protein is facilitated, moreover, due to the oxidizing environment of peripheral mass, disulfide bonds can be formed correctly by the hGH protein, and thus, the protein has good activity.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a preparation method and application of an engineering bacterium that expresses growth hormone efficiently. Background technique [0002] Human growth hormone (human growth bormone, hGH), its mature form is the removal of the signal peptide, a hydrophilic single chain globulin composed of 191 amino acids, its relative molecular weight is about 22kD, and its isoelectric point is 4.9. Two pairs of disulfide bonds are located between Cys53 and Cys165 and between Cys182 and Cys189. hGH is an important non-glycosylated protein hormone secreted by eosinophils in the anterior pituitary gland. Under the stimulation of hypothalamic growth hormone releasing factor, the pituitary gland can release growth hormone, which is transported to various organs and tissues through the blood. Receptors for hGH are found throughout the body, so growth hormone can affect almost...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/18C12N15/70C12N1/21C07K14/61C12R1/19
CPCC12N15/70C07K14/61C07K2319/24
Inventor王库强王峰
Owner湖南百尔泰克生物科技有限公司