Method for heterogenous expression of PEPR1 protein

A protein and exogenous technology, applied in the field of genetic engineering, can solve problems such as not being able to meet the needs of PEPR1 protein

Inactive Publication Date: 2019-03-01
BEE RES INST CHINESE ACAD OF AGRI SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Such expression is far from meeting the needs of subsequent industries for PEPR1 protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for heterogenous expression of PEPR1 protein
  • Method for heterogenous expression of PEPR1 protein
  • Method for heterogenous expression of PEPR1 protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1 Obtaining of PEPR1 gene exons

[0047] Considering that there is no intron region in the extracellular coding region of PEPR1, the present invention directly amplifies the extracellular domain of PEPR1 from the Arabidopsis genome. In the PCR amplification experiment, high-fidelity PCR enzymes were selected to prevent base mutations during the amplification process, and the primer sequences used were as follows.

[0048] PEPR1_29_BamHI_5: CGCGGATCCTTAAACTCAGATGGGCTAAC

[0049] (SEQ ID NO.4)

[0050] PEPR1_767_6His_SalI_3T: AGGAAGAGTGGCCTTAGCACCCATCATCATCATCATCATTAAGTCGACGTC (SEQ ID NO. 5)

[0051] PCR amplification reaction system: 5 μL 10×pfu buffer, 2.5 μL dNTP (2.5 mM), 0.5 μL each of 0.1 μM upstream and downstream primers, 1 μL pfu polymerase, 0.5 μL template, add double distilled water to 50 μL. The PCR amplification reaction conditions were 95°C, 5min; a total of 30 cycles: 94°C for 30s, 53°C for 30s, and 72°C for 600bp / min to calculate the required ex...

Embodiment 2

[0053] Example 2 Exogenous expression vector pFastBac TM Construction of Hem

[0054] Signal peptides play an important role in the process of protein expression and processing. During exogenous expression of plant proteins such as PEPR1 in insect cells, it is unknown whether the signal peptides of plant proteins can still function normally when transferred to insect cells. own function, so this embodiment uses the baculovirus expression vector pFastBac in the insect cell expression system TM 1( image 3 ) was transformed, and the newly transformed carrier was pFastBac TM -Hem( Figure 4A and Figure 4B ). i.e. in pFastBac TM 1 A baculovirus-derived Hemolinpeptide signal peptide is added to the front end of the vector connected to the N-terminus of the target gene, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0055] The present invention unexpectedly finds that the use of the Hem signal peptide is better than the use of the N-terminal signal peptide of PE...

Embodiment 3

[0057] Example 3 PEPR1 gene exons and exogenous expression vector pFastBac TM Hem ligation and preparation of recombinant bacmid

[0058] The choice of restriction endonucleases is based on the fact that the cut sequences of the two restriction endonucleases selected on both sides of the gene cannot appear in the target gene sequence, otherwise, in the later enzyme digestion experiment, the required The gene sequence connected into the vector will be cut by restriction endonucleases, so that a successful recombinant plasmid cannot be obtained. Based on the above principles, in this embodiment, two pairs of restriction endonucleases BamH1 and Xho1, Bgl2 and Sal1 were selected when screening enzyme cutting sites. BamH1 and Bgl2 are homologous to each other, and Xho1 and Sal1 are homologous to each other.

[0059] These two groups of homologous enzymes digest the target gene obtained in Example 1, and one of each group of homologous enzymes is selected, and used in pairs. Ther...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a method for heterogenous expression of PEPR1 protein. The method comprises the following steps of adding Hemolin signal peptides in front of a BamH1 digestion site of pFastBac<TM>1 to obtain a pFastBac<TM>Hem vector; performing digestion on a PEPR1 gene by BamH1 and Sal1; performing digestion on the pFastBac<TM>Hem vector by using BamH1 and Xho1; performing connection afterthe digestion; building an heterogenous expression vector; transfecting an insect cell by the heterogenous expression vector; after the cell is cultured, harvesting the cells and supernatant; performing chromatography and purification on the supernatant to obtain the PEPR1 protein with the correct conformation. The expression quantity reaches 2.24 mg / L. The method overcomes the defect that in theprior art, the PEPR1 protein with the correct conformation cannot be obtained by using a prokaryotic expression system, or when other eukaryotic expression systems are used, the expression quantity of the PEPR1 protein is low. The expression quantity of the PEPR1 protein with the correct conformation is improved; the cost is reduced.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for exogenously expressing PEPR1 protein. Background technique [0002] PEPR1 is a leucine-rich repeat receptor kinase (LRR-RK) in the model plant Arabidopsis thaliana. The LRR-RK family is divided into 16 subfamilies, which is the most deeply studied Receptor protein kinase, which consists of a leucine-rich repeat-like extracellular recognition domain, a single transmembrane domain, and an intracellular kinase domain. PEPR1 protein belongs to the sixth family member of LRR-RK. There are 27 LRR units in the extracellular region of PEPR1, and a pair of cysteines at the N-terminus and C-terminus each form a "cap" structure to stabilize the hydrophobic core of the extracellular region. [0003] PEPR1 receptor protein kinase recognizes a type of endogenous polypeptide molecule secreted by the plant itself, called the damage molecule-associated pattern, which is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/866C12N9/12C12Q1/34
CPCC12N9/1205C12N15/86C12N2710/14043C12N2800/105C12Q1/34C12Y207/01037G01N2333/91215
Inventor汤娇孙亚东韩志富柴继杰石巍
OwnerBEE RES INST CHINESE ACAD OF AGRI SCI