A method for recognizing target protein cd71 and application of nucleic acid aptamer
A nucleic acid aptamer and target protein technology, applied in the field of recognition of the target protein CD71, can solve the problems of small molecular weight and low tumor targeting, and achieve the effects of easy modification, convenient synthesis and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1: Target type identification of nucleic acid aptamer TY8
[0058] The experimental steps are as follows:
[0059] (1) Preparation of ssDNA: The newly synthesized ssDNA was in the form of powder, added sterile water to make a 10 μM system, and stored at -20°C. Take 50 μM nucleic acid aptamer TY8 and library (library), denature at 95°C for 5 minutes, then renature on ice for 10 minutes, centrifuge at 5000 rpm at 4°C for 3 minutes, add Binding buffer to make the DNA concentration 250nM, and place on ice for use.
[0060] ssDNA sequence (TY8):
[0061] ACTCATAGGGTTAGGGGCTGCTGGCCAGATACTCAGATGGTAGGGTTACTATGAGC;
[0062] (2) Preparation of cells: Culture PL45 cells in four dishes until the logarithmic growth phase, discard the medium, wash twice with 2mL DPBS, add 200μl 0.25% trypsin and 200μl 0.1mg / ml of proteinase K was digested at room temperature for 10 min, and the other two dishes were digested with 0.2% EDTA under the same conditions, and then 500 μl of com...
Embodiment 2
[0064] Example 2: Nucleic acid aptamer target mass spectrometric identification
[0065] 1) Extraction of cell membrane proteins
[0066] (1) Inoculate PL45 cells in a 10cm culture dish and culture for 24 hours, about 10 large dishes;
[0067] (2) Discard the old culture medium and wash it twice with DPBS;
[0068] (3) Add EDTA to the cells to digest at room temperature, then discard the EDTA, blow off the cells with DPBS, and collect them in a 15mL centrifuge tube;
[0069] (4) Centrifuge and wash with Washing buffer, discard the supernatant;
[0070] (5) Add a corresponding amount of hypotonic buffer (300 μL / dish) into a 15 mL centrifuge tube, vortex and mix well, and shake at 4° C. for 30 min. After centrifugation, 4000rpm, 10min, discard the supernatant. Then wash with hypotonic buffer 3 times;
[0071] (6) Add a corresponding amount of membrane protein lysate (200 μL / dish) to the centrifuge tube, vortex and mix, and then lyse at 4°C for 30 minutes, then centrifuge to...
Embodiment 3
[0089] Example 3: Co-localization of TY8 and CD71 protein
[0090] Laser confocal fluorescence microscopy can visually display the fluorescent signals on the cell surface. In this experiment, the colocalization experiment of nucleic acid aptamer and CD71 protein was carried out by laser confocal fluorescence microscopy, which further proved that the target of TY8 is CD71 protein.
[0091] The specific experimental steps are as follows:
[0092] (1) Cell preparation: PL45 cells were connected to the optical culture dish 24 hours in advance, so that the confluence of the cells reached 90%-95%, washed three times with Washing buffer, blocked with 1% BSA for 30 minutes, and discarded after blocking.
[0093] (2) Preparation of TY8 and antibody:
[0094] There are three sets of samples:
[0095]Group 1: Add 50 pmol of TY8 labeled with FITC fluorophore at the 5′ end to a 1.5 mL EP tube containing 200 μL of Binding buffer;
[0096] Group 2: Add 50 pmol of TY8 labeled with FITC flu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More