Unlock instant, AI-driven research and patent intelligence for your innovation.

A method for recognizing target protein cd71 and application of nucleic acid aptamer

A nucleic acid aptamer and target protein technology, applied in the field of recognition of the target protein CD71, can solve the problems of small molecular weight and low tumor targeting, and achieve the effects of easy modification, convenient synthesis and low cost

Active Publication Date: 2020-09-04
HUNAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Small molecular compounds, such as folic acid (FA), have small molecular weight and good stability, but they are not highly targeted to tumors, because renal proximal tubules and cerebrovascular choroid plexus also have high expression of folic acid receptors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for recognizing target protein cd71 and application of nucleic acid aptamer
  • A method for recognizing target protein cd71 and application of nucleic acid aptamer
  • A method for recognizing target protein cd71 and application of nucleic acid aptamer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1: Target type identification of nucleic acid aptamer TY8

[0058] The experimental steps are as follows:

[0059] (1) Preparation of ssDNA: The newly synthesized ssDNA was in the form of powder, added sterile water to make a 10 μM system, and stored at -20°C. Take 50 μM nucleic acid aptamer TY8 and library (library), denature at 95°C for 5 minutes, then renature on ice for 10 minutes, centrifuge at 5000 rpm at 4°C for 3 minutes, add Binding buffer to make the DNA concentration 250nM, and place on ice for use.

[0060] ssDNA sequence (TY8):

[0061] ACTCATAGGGTTAGGGGCTGCTGGCCAGATACTCAGATGGTAGGGTTACTATGAGC;

[0062] (2) Preparation of cells: Culture PL45 cells in four dishes until the logarithmic growth phase, discard the medium, wash twice with 2mL DPBS, add 200μl 0.25% trypsin and 200μl 0.1mg / ml of proteinase K was digested at room temperature for 10 min, and the other two dishes were digested with 0.2% EDTA under the same conditions, and then 500 μl of com...

Embodiment 2

[0064] Example 2: Nucleic acid aptamer target mass spectrometric identification

[0065] 1) Extraction of cell membrane proteins

[0066] (1) Inoculate PL45 cells in a 10cm culture dish and culture for 24 hours, about 10 large dishes;

[0067] (2) Discard the old culture medium and wash it twice with DPBS;

[0068] (3) Add EDTA to the cells to digest at room temperature, then discard the EDTA, blow off the cells with DPBS, and collect them in a 15mL centrifuge tube;

[0069] (4) Centrifuge and wash with Washing buffer, discard the supernatant;

[0070] (5) Add a corresponding amount of hypotonic buffer (300 μL / dish) into a 15 mL centrifuge tube, vortex and mix well, and shake at 4° C. for 30 min. After centrifugation, 4000rpm, 10min, discard the supernatant. Then wash with hypotonic buffer 3 times;

[0071] (6) Add a corresponding amount of membrane protein lysate (200 μL / dish) to the centrifuge tube, vortex and mix, and then lyse at 4°C for 30 minutes, then centrifuge to...

Embodiment 3

[0089] Example 3: Co-localization of TY8 and CD71 protein

[0090] Laser confocal fluorescence microscopy can visually display the fluorescent signals on the cell surface. In this experiment, the colocalization experiment of nucleic acid aptamer and CD71 protein was carried out by laser confocal fluorescence microscopy, which further proved that the target of TY8 is CD71 protein.

[0091] The specific experimental steps are as follows:

[0092] (1) Cell preparation: PL45 cells were connected to the optical culture dish 24 hours in advance, so that the confluence of the cells reached 90%-95%, washed three times with Washing buffer, blocked with 1% BSA for 30 minutes, and discarded after blocking.

[0093] (2) Preparation of TY8 and antibody:

[0094] There are three sets of samples:

[0095]Group 1: Add 50 pmol of TY8 labeled with FITC fluorophore at the 5′ end to a 1.5 mL EP tube containing 200 μL of Binding buffer;

[0096] Group 2: Add 50 pmol of TY8 labeled with FITC flu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for recognizing target protein CD71 and application of a DNA aptamer, particularly application to preparation of a target protein CD71 preparation and a tumor targeted medicine carrying preparation. The invention provides a novel method capable of recognizing the cell surface marking protein. The recognized marking protein CD71 realizes high expression on the surfaces of various tumor cells, so that the specific recognition CD71 of the DNA aptamer can be used for the study on various tumor cells. The CD71 protein can be internalized by the cells, so that the DNA aptamer of the targeted CD71 can be used as a target aptamer to be coupled with the antitumor medicine to build a targeted delivery system so as to realize the targeted treatment of the tumor.

Description

technical field [0001] The invention relates to a method for recognizing target protein CD71, and the application of a nucleic acid aptamer in preparing preparations for recognizing target protein CD71 and tumor-targeted drug-carrying preparations. Background technique [0002] Nucleic acid aptamer (aptamer) is a single-stranded DNA or RNA that can bind to target molecules with high affinity and is screened from a random single-stranded oligonucleotide library by SELEX (systematic evolution of ligands by exponential enrichment) technology. . Aptamers have the characteristics of wide target molecules, high affinity, and strong specificity due to their structural diversity. At the same time, compared with traditional antibodies, aptamers have smaller molecular weights, are easy to modify, are convenient to prepare, and are non-immunogenic. Therefore, aptamers have shown broad application prospects in basic research, clinical diagnosis, and drug development. [0003] The occu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/115G01N33/53A61K47/54A61K45/00A61P35/00
CPCA61K45/00A61K47/549A61P35/00C12N15/115C12N2310/16G01N33/53
Inventor 谭蔚泓叶茂张慧金程彭波
Owner HUNAN UNIV