Method for obtaining new variety of high-resistance white moth plasmid transgenic Bt poplar

A new variety and gene technology, applied in the field of obtaining new poplar varieties with high resistance to white moth plastid transgenic Bt gene, can solve the problems of gene integration site uncertainty, unstable expression, gene escape, etc.

Inactive Publication Date: 2019-04-16
HUBEI UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0015] At present, all transgenic Bt poplars are nuclear transgenes. The shortcomings of nuclear transgenes, such as the uncertainty of gene integration sites, unstable expression levels, and gene escape, are currently difficult to overcome.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for obtaining new variety of high-resistance white moth plasmid transgenic Bt poplar
  • Method for obtaining new variety of high-resistance white moth plasmid transgenic Bt poplar
  • Method for obtaining new variety of high-resistance white moth plasmid transgenic Bt poplar

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] The construction of the plastid transformation vector of Bt-cry1C gene Populus montana:

[0063] Using pBar13-cry1C plasmid DNA as a template,

[0064] Use cry1C-F (5'GCGGCCGCCTACTTTTGTGCTCTTTCAAGGTCAGATT3'SEQ ID NO: 2) and cry1C-R (5'CCATGGAGGAGAACAATCAGAACCAGTG3'SEQ ID NO: 3) this pair of primers, and then use Pfu enzyme to amplify the cry1C gene sequence by PCR. After clean kit purification, with blunt-ended carrier After Simple ligation, transform Escherichia coli XL10-gold, and after the obtained recombination is verified by PCR and enzyme digestion, it is sent to a sequencing company for sequencing verification, and the verified correct recombinant is named pYY23. Digest the pYY23 plasmid DNA with restriction endonucleases Nco I and Not I, and after agarose gel electrophoresis, cut out the small fragments on the corresponding gel, recover them with a gel recovery kit, and extract the small fragments Ligate with the large fragment obtained after double-enzyme cu...

Embodiment 2

[0066] Using gene gun method to introduce pYY25 plasmid DNA into the genome of Populus japonicus and screening of resistant buds:

[0067] The pYY25 plasmid DNA was wrapped with 0.6 μm gold powder, and the poplar leaves were bombarded with a Bio-Rad gene gun (PDS-1000 / He). 9cm), vacuum degree 28. The specific operation was carried out according to the gene gun operation manual, and was carried out with reference to the poplar plastid gene gun transformation method. The leaf material bombarded by the gene gun was cut into a size of 3*3mm, placed on the PaSIM1 selection medium containing 30mg / L spectinomycin with the abaxial side up until resistant buds appeared, on this medium every 1- The culture medium was changed once every February. The screening culture conditions are: 25°C 16h light / 20°C 8h dark, light intensity: 20-25μE·m -2 ·s -1 .

Embodiment 3

[0069] Obtaining and Molecular Identification of Plastid Transgenic Bt-cry1C Gene Populus montana Plants:

[0070] Preliminary identification of the resistant buds of Populus japonicus transfected with Bt-cry1C gene: the leaves of the resistant buds grown on 30mg / L spectinomycin PaSIM2 and the leaves of wild type poplar japonicus cultivated conventionally were taken to extract the total DNA of the leaves as The template was tested by PCR with primers JC-Pa-F (5'GGGTATATCTCTTCTTAAAGTTAAACTGCAGTATTTG3'SEQ ID NO: 4) and JC-Pa-R (5'CGGTACTTGTGATATTTCGGCTTG 3'SEQ ID NO: 5), and it was found that: The control and the wild-type control did not amplify to a band similar to the size of the gene (1903bp), while the transgenic Bt-cry1C gene Pa-YY25#3 strain and Pa-YY25#4 strain were amplified to a band similar to the gene size (1903bp). The similar bands of the gene size (1903bp) indicate that the gene has been transferred into the cells of Populus pubescens; the negative control and the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and discloses a method for obtaining a new variety of high-resistance white moth plasmid transgenic Bt poplar. The method comprises the following steps of cloning an artificially-modified Bt-cry1C gene into a new poplar plasmid transformation vector pYY20, performing enzyme digestion verification and PCR verification, and then performing sequence verification to obtain a plasmid transformation vector pYY25 of a Bt-cry1C gene; using gold powders to wrap pYY25 plasmid DNA and introducing the pYY25 plasmid DNA into a chloroplast genome of poplar through a gene gun transformation method, screening by spectinomycin to obtain a plurality of resistant buds, testing by Southern blot to obtain two positive resistant buds, carrying out three-round blade resistance regeneration to obtain homogenized transgenic Bt-cry1C poplar plants. The plasmid transgenic Bt-cry1C poplar is highly lethal to American white moth larvae, thereby obtaining thenew variety of high-resistance white moth plasmid transgenic Bt poplar.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for obtaining a new poplar variety with high resistance to white moth plastid transfection Bt gene. Background technique [0002] At present, the existing technologies commonly used in the industry are as follows: [0003] Poplar (Populus L.) is a plant of the genus Populus, with more than 100 species in the genus. It is the most widely distributed and most adaptable tree species in the world. There are about 62 species (including 6 hybrids) in China, of which 57 species are distributed in China, and about 4 species are introduced and cultivated. In addition, there are many varieties, variants and introduced strains. The distribution range in China spans 25° to 53° north latitude and 76° to 134° east longitude, covering the northeast, northwest, north and southwest of China. [0004] Poplar is an important economic tree and model woody plant. Due to its fast g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/29C12N15/66A01H4/00A01H5/00A01H6/00
CPCC07K14/415C12N15/66C12N15/8286
Inventor张江武江峰武玉永马美琪徐乐天常玲李圣纯
OwnerHUBEI UNIV