Unlock instant, AI-driven research and patent intelligence for your innovation.

Dimerized fusion protein and preparation method and application thereof

A fusion protein and doublet technology, applied in chemical instruments and methods, peptide/protein components, hybrid peptides, etc., can solve the problems of reduced biological activity in vitro, increased difficulty in protein purification, and increased risk of immune reactions

Active Publication Date: 2019-05-14
LANZHOU UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The researchers found that HSA fusion proteins would have some common problems during the expression and production process. For example, HSA fusion proteins would aggregate or degrade during expression and storage, and their in vitro biological activity would be reduced to varying degrees. (Cordes AA et al., 2012, 2012; Liu Wenhui, 2015), this phenomenon not only increases the difficulty of protein purification, but also increases the risk of immune reactions during clinical medication

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dimerized fusion protein and preparation method and application thereof
  • Dimerized fusion protein and preparation method and application thereof
  • Dimerized fusion protein and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1 Construction of TMP-L1-TMP-L2-3DHSA Fusion Protein Mammalian Expression Vector

[0062] 1. Construction of pcDNA3-TMP-L1-TMP-L2-3DHSAF expression vector

[0063] The acquisition of ss(Fc)-TMP-L1-TMP-L2-H-fip gene sequence: the gene sequence ss-TMP-L-TMP was synthesized in Bao Bioengineering (Dalian) Co., Ltd. (ss is the signal peptide sequence of the Fc fragment, TMP is a mimetic peptide. Using the plasmid pMD19-T-ss-TMP-L1-TMP as a template, use primers P1 (ctggatggcctccatcagctcgtccctgctcacgcacggtgggcatgtgtgagtttttg) and P2 (gaagaagctttgctatggagacagacacactcct) to carry out the first round of amplification to obtain ss-TMP-L1-TMP, and then use the The PCR product was used as a template, and primers P3 (gaagaagctttgctatggagacagacacactcct) and P4 (gaagctgcagcctgaagttgatctcctcctgcttctggatggcctccatcagctcgtc) were used to amplify the ss(Fc)-TMP-L1-TMP-L2-H-fip gene fragment, and the restriction enzymes HindIII and PstI were used for double enzyme The digested prod...

Embodiment 2 2

[0076] Example 2 Expression of Dimerized Thrombopoietin Mimetic Peptide TMP Duplex-Human Serum Albumin Third Domain Fusion Protein in Mammalian Cell CHO-S

[0077] Chinese hamster ovary suspension cell CHO-S, purchased from Invitrogen Corporation of the United States, is a kind of wild-type CHO cell adapted to high-density, serum-free suspension culture after domestication and cultivation, and can produce a large amount of secreted recombinant protein. Since 2012, our laboratory has been working on the expression of fusion protein by CHO-S cells, and established the optimized transient transfection and fusion protein expression system of fusion protein expression vector.

[0078] Prepare CD-FortiCHOTM complete medium preparation before cell recovery. Add 200mM L-glutamine to the CD-FortiCHOTM culture medium to make the final concentration 8mM. Store in the dark at 2-8°C for later use, and preheat in a 37°C water bath before use. Take out the CHO-S cell cryopreservation tube ...

Embodiment 3

[0080] Example 3 fusion protein live dual luciferase activity detection results

[0081] TPO receptor c-mpl widely exists in hematopoietic tissues (including stem cells, megakaryocyte cell line colony-forming cells, etc.), and is a transmembrane protein receptor. TPO or TPO mimic peptide TMP binds to the extramembrane region of c-mpl receptor, c-mpl polymerizes into a homodimer, activates various signals such as JAK2-STAT5, Shc-Ras-MAPK, anti-apoptosis pathways in cells pathway, leading to increased platelet production. At the same time, the phosphorylated STAT5 dimer enters the nucleus and binds to the c-fos promoter, thereby triggering the expression of the downstream firefly luciferase gene. Therefore, by detecting the luminescent signal intensity of the firefly luciferase substrate in the cells, the purpose of detecting the activity of the TMP recombinant protein sample on the c-mpl receptor can be achieved.

[0082] In this experiment, the Renilla constitutive expressio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic engineering pharmacy, and in particular to a dimerized fusion protein and a preparation method and application thereof. The dimerized fusion protein comprises one thrombopoietin mimetic peptide (TMP) double protein domain and the third domain of human serum albumin (3DHSA), wherein the TMP dimers, the TMP dimer and the 3DHSA are linked by a connectingpeptide and a dimerisation domain. The dimerized fusion protein of the TMP dimer and the third domain of human serum albumin can act with the thrombopoietin receptor c-mpl, has the activity of stimulating the proliferation of TPO-dependent cell lines, and can be expressed in mammalian cells. The dimerized fusion protein can be used for preparing thrombopoietin medicaments and is an effective candidate medicament for thrombopoietin. The dimerized fusion protein also provides a preparation method of the dimerized fusion protein of the TMP dimer and the third domain of human serum albumin.

Description

technical field [0001] The invention belongs to the field of genetic engineering pharmaceuticals, in particular to a thrombopoietin mimetic peptide (TMP) duplex-dimer of the third domain of human serum albumin (The third domain of human serum albumin, 3DHSA) Fusion protein and its preparation method and application. Background technique [0002] With the maturity of DNA recombination technology and the development of biopharmaceutical technology, recombinant protein drugs have become a hot field of new drug research because of their clear amino acid sequence and base sequence and high safety, and have broad development prospects. However, many small-molecular-weight peptide drugs are easily degraded in the body or eliminated by the kidneys due to their small molecular weight and unstable molecular structure, resulting in a short retention time of such drugs in plasma (Jin Guangze et al., 2010). Multiple injections of drugs in a short period of time will not only cause insta...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/85A61K38/19A61P7/04
CPCY02A50/30
Inventor 李红玉张丽芸王梅竹茹毅支德娟李洋陈晓雨赵晶戴治娟
Owner LANZHOU UNIVERSITY