Dimerized fusion protein and preparation method and application thereof
A fusion protein and doublet technology, applied in chemical instruments and methods, peptide/protein components, hybrid peptides, etc., can solve the problems of reduced biological activity in vitro, increased difficulty in protein purification, and increased risk of immune reactions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] Example 1 Construction of TMP-L1-TMP-L2-3DHSA Fusion Protein Mammalian Expression Vector
[0062] 1. Construction of pcDNA3-TMP-L1-TMP-L2-3DHSAF expression vector
[0063] The acquisition of ss(Fc)-TMP-L1-TMP-L2-H-fip gene sequence: the gene sequence ss-TMP-L-TMP was synthesized in Bao Bioengineering (Dalian) Co., Ltd. (ss is the signal peptide sequence of the Fc fragment, TMP is a mimetic peptide. Using the plasmid pMD19-T-ss-TMP-L1-TMP as a template, use primers P1 (ctggatggcctccatcagctcgtccctgctcacgcacggtgggcatgtgtgagtttttg) and P2 (gaagaagctttgctatggagacagacacactcct) to carry out the first round of amplification to obtain ss-TMP-L1-TMP, and then use the The PCR product was used as a template, and primers P3 (gaagaagctttgctatggagacagacacactcct) and P4 (gaagctgcagcctgaagttgatctcctcctgcttctggatggcctccatcagctcgtc) were used to amplify the ss(Fc)-TMP-L1-TMP-L2-H-fip gene fragment, and the restriction enzymes HindIII and PstI were used for double enzyme The digested prod...
Embodiment 2 2
[0076] Example 2 Expression of Dimerized Thrombopoietin Mimetic Peptide TMP Duplex-Human Serum Albumin Third Domain Fusion Protein in Mammalian Cell CHO-S
[0077] Chinese hamster ovary suspension cell CHO-S, purchased from Invitrogen Corporation of the United States, is a kind of wild-type CHO cell adapted to high-density, serum-free suspension culture after domestication and cultivation, and can produce a large amount of secreted recombinant protein. Since 2012, our laboratory has been working on the expression of fusion protein by CHO-S cells, and established the optimized transient transfection and fusion protein expression system of fusion protein expression vector.
[0078] Prepare CD-FortiCHOTM complete medium preparation before cell recovery. Add 200mM L-glutamine to the CD-FortiCHOTM culture medium to make the final concentration 8mM. Store in the dark at 2-8°C for later use, and preheat in a 37°C water bath before use. Take out the CHO-S cell cryopreservation tube ...
Embodiment 3
[0080] Example 3 fusion protein live dual luciferase activity detection results
[0081] TPO receptor c-mpl widely exists in hematopoietic tissues (including stem cells, megakaryocyte cell line colony-forming cells, etc.), and is a transmembrane protein receptor. TPO or TPO mimic peptide TMP binds to the extramembrane region of c-mpl receptor, c-mpl polymerizes into a homodimer, activates various signals such as JAK2-STAT5, Shc-Ras-MAPK, anti-apoptosis pathways in cells pathway, leading to increased platelet production. At the same time, the phosphorylated STAT5 dimer enters the nucleus and binds to the c-fos promoter, thereby triggering the expression of the downstream firefly luciferase gene. Therefore, by detecting the luminescent signal intensity of the firefly luciferase substrate in the cells, the purpose of detecting the activity of the TMP recombinant protein sample on the c-mpl receptor can be achieved.
[0082] In this experiment, the Renilla constitutive expressio...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


