Method for expressing and purifying recombinant human sex hormone haptoglobin N-terminal 51-218aa

A combination of globulin and expression method technology, applied in the field of expression and purification of recombinant human sex hormone binding globulin N-terminal 51-218aa, which can solve the problems of expensive kits and restrictions on the promotion and application of SHBG detection

Inactive Publication Date: 2019-06-07
GUANGXI MEDICAL UNIVERSITY
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, methods for detecting SHBG levels include enzyme-linked immunosorbent assay, precipitation method, chemiluminescence immunoassay, etc., especially the imported kits of enzyme-linked immunosorbent assay are expensive, which limits the promotion and application of SHBG detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for expressing and purifying recombinant human sex hormone haptoglobin N-terminal 51-218aa
  • Method for expressing and purifying recombinant human sex hormone haptoglobin N-terminal 51-218aa
  • Method for expressing and purifying recombinant human sex hormone haptoglobin N-terminal 51-218aa

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Construction of expression vector pET30a(+)-SHBG(151-654bp)

[0023] 1.1 PCR to obtain SHBG (151-654bp)

[0024] Total RNA was extracted from 7702 human hepatocytes using the RNA extraction kit from TaKaRa Company, and the cDNA obtained by reverse transcription was used as a template to amplify the target fragment. PCR reaction system: 0.4ul upstream and downstream primers, 2.0ul template, PCR PfuSuperMix 10ul, wxya 2 O 7.2ul; pre-denaturation at 95°C for 1min, denaturation at 95°C for 20s, annealing at 68°C for 20s, extension at 72°C for 45s, 40 cycles, extension at 72°C for 5min, the PCR product was identified by 1.2% agarose gel electrophoresis, and the target item was cut out Band position for agarose gel recovery (OMEGA). Depend on figure 1 It can be seen that there is a clear bright band at about 500bp, which is consistent with the expected size.

[0025] Upstream primer: AAA GGATCC CCAGGACAAGAGCCTATCGC (the underline is BamH I restriction enzyme site)

[0...

Embodiment 2

[0033] Prokaryotic expression of N-terminal 51-218aa of recombinant SHBG protein

[0034] 2.1 Transform the pET30a(+)-SHBG(151-654bp) recombinant plasmid into the expression host Escherichia coli BL21(DE3) to obtain a recombinant engineering strain, namely BL21-SHBG(151-654bp).

[0035] 2.2 Induced expression: The recombinant engineered strain BL21-SHBG (151-654bp) was picked and inoculated in LB liquid medium (containing 25ug / mL kanamycin), overnight at 37°C and 200rpm. The next day, inoculate 10% of the inoculum into fresh LB liquid medium (containing 25ug / mL kanamycin), shake and culture at 37°C and 200rpm for about 2.5h-3h, add IPTG with a final concentration of 1mM to induce, At the same time, the plasmid pET30a(+) negative control was carried out, and induced for 4.5 hours at 37° C. and 200 rpm. The bacteria were centrifuged at 2500g for 30min at 4°C to collect the lower layer of bacteria. Resuspend the bacteria with an appropriate amount of PBS buffer, carry out 12% c...

Embodiment 3

[0037] Purification of N-terminal 51-218aa of recombinant SHBG protein

[0038] 3.1 Inclusion body treatment: Resuspend the bacteria with an appropriate amount of pre-cooled PBS buffer, sonicate in an ice bath (380W, 60min, 5s on, 6s off), centrifuge at 12000rpm for 10min at 4°C, and collect the precipitated inclusion bodies. Wash the inclusion bodies with an appropriate amount of washing buffer (20mM Tris-HCl, pH 7.9, 500mM NaCl, 10mM imidazole, 1M urea), centrifuge at 12000rpm at 4°C for 10min, and repeat the operation several times until the inclusion bodies are cleaned. Add equilibration buffer (20mM Tris-HCl, pH 7.9, 500mM NaCl, 10mM imidazole, 6M urea) to dissolve the inclusion bodies, and after 1 hour on ice, centrifuge at 10000g for 20min at 4°C to collect the supernatant.

[0039]3.2 Chromatography column: Load the supernatant protein solution into a Ni agarose gel chromatography column and place it in a shaker at 4°C for 2 hours for adsorption. Use 15 times column v...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene cloning and expression, and in particular to a method for expressing and purifying a recombinant human sex hormone haptoglobin N-terminal 51-218aa.According to the invention, Escherichia coli expression and purification of the recombinant human sex hormone haptoglobin are employed to provide a construction method of a recombinant human SHBG protein N-terminal 51-218aa expression vector, and the N-terminal 51-218aa of the recombinant human SHBG protein obtain by induced expression is subjected to Ni-Sepharose chromatographic column and two-step purification. The N-terminal 51-218aa of the recombinant human SHBG protein prepared by the method of the invention has the characteristics of high yield, high purity and low cost, and is useful for further self-developing of a detection kit of the protein.

Description

technical field [0001] The invention relates to the technical field of gene cloning and expression, in particular to a method for expressing and purifying the N-terminal 51-218aa of recombinant human sex hormone-binding globulin. Background technique [0002] Sex hormone-binding globulin (SHBG) is a homodimeric glycoprotein composed of two subunits. It is mainly synthesized and secreted by the liver. It can also be produced by tissues such as the placenta and testis. It can specifically interact with sex hormones. Combine and participate in its transport, regulate the concentration of biologically active sex hormones in the blood, and also be regulated by various factors such as insulin, thyroxine, and adiponectin. In most studies, it has been shown that type 2 diabetes, cardiovascular disease, polycystic ovary syndrome, breast cancer, tuberculosis and other diseases may be accompanied by changes in SHBG levels, suggesting that this protein may be used as a candidate biomark...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/62C07K19/00C07K1/22
Inventor温莎何敏杨丽超李辉陈秋利
OwnerGUANGXI MEDICAL UNIVERSITY