Gene PeMIR393a regulating development of adventitious roots of poplar and its application
A root development and genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of decreased sensitivity to auxin, decreased number of lateral roots in Arabidopsis roots, etc., and achieve the effect of reducing the number of lateral roots
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Cloning of the PeMIR393a gene
[0035] Using Populus Nanlin 895 DNA as material, refer to the poplar genome sequence information (http: / / www.phytozome.net / ), search for the PeMIR393a gene sequence, use Oligo 7 software to design degenerate primers, and amplify the PeMIR393a gene sequence with high fidelity The PCR reaction system is shown in Table 1. Among them, the degenerate primers include: forward primer: 5'CCAGGAAGC TGGTGGAGGACTCC 3'; reverse primer: 5'GAAGGCGCGAGTGGAAAATTCCA3'.
[0036] Among them, the DNA of Populus Nanlin 895 was extracted using a novel genomic DNA extraction kit (DP320) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd.
[0037] Table 1 High-fidelity PCR reaction system
[0038]
[0039] The reaction conditions are as follows: (1) Pre-denaturation at 94°C for 3min; (2) 94°C for 30s-60°C for 30s-72°C for 2min) x 38 cycles; (3) 72°C for 10min. The amplified product was sequenced to obtain the PeMIR393a gene sequence (...
Embodiment 2
[0040] Example 2 Construction of p35S-pBI121-PeMIR393a vector
[0041] (1) A small amount of p2GW7.0-PeMIR393a entry vector was extracted by alkaline lysis; a small amount of 35S-pBI121-GUS expression vector was extracted by alkaline lysis; p2GW7.0-PeMIR393a entry vector and 35S-pBI121-GUS expression vector were used to II Plus enzyme mix ligation, react at 25°C for 2 hours, add 0.5 μl of proteinase K, mix gently, and put it at 37°C for 10 minutes to quench the enzyme to obtain the p35S-pBI121-PeMIR393a vector. The LR cloning reaction system is shown in Table 3.
[0042] Among them, the preparation steps of the p2GW7.0-PeMIR393a entry vector (BP clone) are as follows: perform agarose gel electrophoresis on the PeMIR393a obtained by PCR amplification in Example 1, use a recovery kit (thin agarose gel DNA recovery kit, GK2043 -50, Shanghai Jierui Biological Engineering Co., Ltd.) to purify and recover the target product; mix the recovered target product with the entry carrier p...
Embodiment 3
[0050] Example 3 PeMIR393a gene regulates plant adventitious root development
[0051] By electric shock conversion method (Bio-Rad MicroPulser Bole electrotransfer instrument; electric shock cup: Bio-Rad Bole electric shock cup 1652086; electric shock conditions: output range 200-3000v, precision 10v, use voltage 2.5kv, time constant 1.0ms, precision 0.1ms, Use temperature: room temperature; resistance: rifampicin Rif) the constructed p35S-pBI121-Pe MIR393a is transformed into Agrobacterium strain LBA4404 (Invitrogen), through Agrobacterium-mediated technology (He Guangyuan. Plant Genetic Engineering Experiment Manual [M ]. Beijing: Tsinghua University Press, 2007) the PeMIR393a gene was transferred into Populus montana. Pe-MIR393a transgenic plants were subcultured for about 6 weeks to observe the development of adventitious roots. The rooting speed of transgenic plants was significantly slower than that of non-transgenic plants, and the number of lateral roots was signific...
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



