Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene PeMIR393a regulating development of adventitious roots of poplar and its application

A root development and genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of decreased sensitivity to auxin, decreased number of lateral roots in Arabidopsis roots, etc., and achieve the effect of reducing the number of lateral roots

Active Publication Date: 2019-07-19
NANJING FORESTRY UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Parry et al. (2009) found that the overexpression of miR393 can lead to a decrease in the number of lateral roots in Arabidopsis root development and a decrease in sensitivity to auxin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene PeMIR393a regulating development of adventitious roots of poplar and its application
  • Gene PeMIR393a regulating development of adventitious roots of poplar and its application
  • Gene PeMIR393a regulating development of adventitious roots of poplar and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Cloning of the PeMIR393a gene

[0035] Using Populus Nanlin 895 DNA as material, refer to the poplar genome sequence information (http: / / www.phytozome.net / ), search for the PeMIR393a gene sequence, use Oligo 7 software to design degenerate primers, and amplify the PeMIR393a gene sequence with high fidelity The PCR reaction system is shown in Table 1. Among them, the degenerate primers include: forward primer: 5'CCAGGAAGC TGGTGGAGGACTCC 3'; reverse primer: 5'GAAGGCGCGAGTGGAAAATTCCA3'.

[0036] Among them, the DNA of Populus Nanlin 895 was extracted using a novel genomic DNA extraction kit (DP320) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0037] Table 1 High-fidelity PCR reaction system

[0038]

[0039] The reaction conditions are as follows: (1) Pre-denaturation at 94°C for 3min; (2) 94°C for 30s-60°C for 30s-72°C for 2min) x 38 cycles; (3) 72°C for 10min. The amplified product was sequenced to obtain the PeMIR393a gene sequence (...

Embodiment 2

[0040] Example 2 Construction of p35S-pBI121-PeMIR393a vector

[0041] (1) A small amount of p2GW7.0-PeMIR393a entry vector was extracted by alkaline lysis; a small amount of 35S-pBI121-GUS expression vector was extracted by alkaline lysis; p2GW7.0-PeMIR393a entry vector and 35S-pBI121-GUS expression vector were used to II Plus enzyme mix ligation, react at 25°C for 2 hours, add 0.5 μl of proteinase K, mix gently, and put it at 37°C for 10 minutes to quench the enzyme to obtain the p35S-pBI121-PeMIR393a vector. The LR cloning reaction system is shown in Table 3.

[0042] Among them, the preparation steps of the p2GW7.0-PeMIR393a entry vector (BP clone) are as follows: perform agarose gel electrophoresis on the PeMIR393a obtained by PCR amplification in Example 1, use a recovery kit (thin agarose gel DNA recovery kit, GK2043 -50, Shanghai Jierui Biological Engineering Co., Ltd.) to purify and recover the target product; mix the recovered target product with the entry carrier p...

Embodiment 3

[0050] Example 3 PeMIR393a gene regulates plant adventitious root development

[0051] By electric shock conversion method (Bio-Rad MicroPulser Bole electrotransfer instrument; electric shock cup: Bio-Rad Bole electric shock cup 1652086; electric shock conditions: output range 200-3000v, precision 10v, use voltage 2.5kv, time constant 1.0ms, precision 0.1ms, Use temperature: room temperature; resistance: rifampicin Rif) the constructed p35S-pBI121-Pe MIR393a is transformed into Agrobacterium strain LBA4404 (Invitrogen), through Agrobacterium-mediated technology (He Guangyuan. Plant Genetic Engineering Experiment Manual [M ]. Beijing: Tsinghua University Press, 2007) the PeMIR393a gene was transferred into Populus montana. Pe-MIR393a transgenic plants were subcultured for about 6 weeks to observe the development of adventitious roots. The rooting speed of transgenic plants was significantly slower than that of non-transgenic plants, and the number of lateral roots was signific...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene PeMIR393a regulating development of adventitious roots of poplar, which is derived from Nanlin 895 Yang. According to the invention, an Agrobacterium-mediated technologyis used to convert the PeMIR393a gene into Shanxinyang to obtain transgenic Shanxinyang, and the adventitious root result of the transgenic Shanxinyang shows that the rooting rate is significantly slower than that of non-transgenic plants, the number of lateral roots is significantly reduced, and the formation of secondary lateral roots can be inhibited.

Description

technical field [0001] The invention relates to the field of plant genetic engineering, in particular to a gene PeMIR393a regulating adventitious root development of poplar and application thereof. Background technique [0002] The root is an important organ for plants to absorb water and nutrients and support the above-ground parts. The growth of the root system is directly related to the growth state of the plant. Roots are generally divided into embryonic roots and postembryonic roots, embryonic roots generally refer to taproots and lateral roots, and postembryonic roots are also called adventitious roots. In the process of plant sexual reproduction, it mainly promotes the growth of embryonic roots, while in the process of asexual reproduction, it promotes the growth of adventitious roots. Forest trees are more suitable for vegetative propagation due to their long growth cycle. Rooting traits play a key role in their vegetative propagation and cutting afforestation, and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/74C12N15/82A01H5/00A01H6/00
CPCC07K14/415C12N15/743C12N15/8261
Inventor 陈英李爽爽王浩然王光萍乐丽娜滕青云黄敏仁
Owner NANJING FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com