Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Environmental stimulation responsive protein polymer conjugate self-assembled body and preparation method and application thereof

A technology of environmental stimulation and high molecular polymer, which is applied in the field of biomedical nanomaterials, can solve the problems of improving the level of pharmacokinetics, difficult drug stability and activity, etc.

Active Publication Date: 2019-08-09
PEKING UNIV
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods are difficult to effectively maintain the stability and activity of the drug, and fail to further significantly improve the pharmacokinetic level

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Environmental stimulation responsive protein polymer conjugate self-assembled body and preparation method and application thereof
  • Environmental stimulation responsive protein polymer conjugate self-assembled body and preparation method and application thereof
  • Environmental stimulation responsive protein polymer conjugate self-assembled body and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0087] Example 1 Construction of IFNα-ELP diblock Fusion protein plasmid and expressed in E. coli

[0088] Isoleucine I is selected as the X amino acid of the hydrophobic ELP block, and the amino acid repeating unit of the ELP (I) sequence is: (IGVPG), which is repeated 48 times.

[0089] Gene fragments containing repeat units and BseRI / Acul cohesive ends were synthesized by Sangon Biotechnology (Shanghai, China).

[0090] Upstream fragment: 5'GCATTGGTGTGCCGGGGATCGGTGTTCCGGGC3' (SEQ ID NO: 1)

[0091] Downstream fragment: 5'TAGCCCGGAACACCGATCCCCGGCACACCAAT3' (SEQ ID NO: 2)

[0092] The pET-24a(+) vector was inserted into the pET-24a(+) vector through the BseRI / Acul restriction site, and a plasmid with 24 repeating units as above was obtained by rolling circle plasmid construction.

[0093] Alanine A was selected as the X amino acid of the hydrophilic ELP block and the ELP of the control group. The amino acid repeating unit of the ELP (A) sequence was: (AGVPG), which was rep...

Embodiment 2

[0103] Example 2 IFNα-ELP obtained by culturing in Example 1 diblock Purified with IFNα-ELP(A) conjugate

[0104] 1. In this example, IFNα-ELP was purified by inverse transition cycling (Inverse transition cycling, ITC) diblock and IFNα-ELP (A). The specific method is as follows:

[0105] (1) Collect 1L of Escherichia coli culture solution in a centrifuge bottle, collect the cells by centrifugation at 3000×g, and remove the supernatant culture solution.

[0106] (2) The cells were resuspended in 30 mL of ice-cold PBS, and the cells were disrupted by an ultrasonic instrument at 4° C., and then the crushed E. coli products were centrifuged at 4° C. and 14,000×g centrifugal force for 15 minutes.

[0107] (3) Add 2 mL of polyethyleneimine (PEI, 10%) to the supernatant collected in step (2), and centrifuge again for 15 minutes, in order to remove nucleic acid and other negatively charged substances in the cell lysate, and obtain the above ITC purification of the supernatant: ad...

Embodiment 3

[0110] Example 3 Measurement of IFNα-ELP diblock and physicochemical characterization parameters of IFNα-ELP(A)

[0111] (1) Measure the molecular weight of the purified product obtained in Example 2 with matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF), the instrument used is 4800PlusMALDI-TOF / TOF TM Analyzer (AB SCIEX), the results are as image 3 shown, indicating that IFNα-ELP diblock , IFNα-ELP(A) and IFNα molecular weights are close to the theoretical values. That is, a purified protein sample with the correct molecular weight is obtained, which can be used for subsequent experiments.

[0112] (2)IFNα-ELP diblock The secondary structure of the sample is measured by circular dichroism analysis: the sample is diluted to 0.15 mg / mL with an aqueous solution, and the ultraviolet scanning analysis is carried out in the 200-250 nm wavelength range with Pistar π-180 (Applied Photophysics Co., Ltd.), and the results are as follows Fig...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses an environmental stimulation responsive protein polymer conjugate self-assembled body and a preparation method and application thereof and belongs to the field of biomedicine.A protein polymer conjugate of the self-assembled body comprises a protein substance and two or more environmental stimulation responsive polymers coupled with the protein substance and is subjected to environmental stimulation sensitive responsive self-assembly under the action of temperature, enzymes, pH, light, static electricity, magnetic fields, chemical substances and other environments, a self-assembled body structure of the protein polymer conjugate can significantly improve the stability of drugs and effectively maintain the activity of the drugs, the half-life periods of the drugs are significantly prolonged at the same time, and pharmacokinetic parameters are improved; moreover, the preparation method is simple, condition parameters are easy to control, and the self-assembled body has a high practical value. The environmental stimulation responsive protein polymer conjugate self-assembled body has a broad application prospect in the fields of drug preparation and release control over the drugs.

Description

technical field [0001] The invention belongs to the research field of biomedical nanomaterials, and specifically relates to an environmental stimulus-responsive protein polymer conjugate self-assembly and its preparation method and application, more specifically, relates to an environmental stimulus-responsive self-assembled drug delivery carrier, protein drug , and the use of the isolated environment-stimuli-responsive polymer in the preparation of a drug delivery system. Background technique [0002] Protein-polymer conjugates have become the most commonly used method to effectively prolong the circulating half-life of protein drugs because they can increase the hydration radius of small molecular proteins and thus escape renal clearance. Currently, the most common way to address these issues is to modify protein drugs with polyethylene glycol (PEG), a method commonly known as PEGylation. Modification of IFN with polyethylene glycol (PEG) can effectively improve its pharm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K47/64A61K47/69A61K38/21A61P35/00A61P37/00A61P3/00C07K14/56C12N15/21C12N15/70
CPCA61K38/21A61K47/64A61K47/6907A61P3/00A61P35/00A61P37/00C07K14/56C12N15/70
Inventor 高卫平王卓然
Owner PEKING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com