Environmental stimulation responsive protein polymer conjugate self-assembled body and preparation method and application thereof
A technology of environmental stimulation and high molecular polymer, which is applied in the field of biomedical nanomaterials, can solve the problems of improving the level of pharmacokinetics, difficult drug stability and activity, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0087] Example 1 Construction of IFNα-ELP diblock Fusion protein plasmid and expressed in E. coli
[0088] Isoleucine I is selected as the X amino acid of the hydrophobic ELP block, and the amino acid repeating unit of the ELP (I) sequence is: (IGVPG), which is repeated 48 times.
[0089] Gene fragments containing repeat units and BseRI / Acul cohesive ends were synthesized by Sangon Biotechnology (Shanghai, China).
[0090] Upstream fragment: 5'GCATTGGTGTGCCGGGGATCGGTGTTCCGGGC3' (SEQ ID NO: 1)
[0091] Downstream fragment: 5'TAGCCCGGAACACCGATCCCCGGCACACCAAT3' (SEQ ID NO: 2)
[0092] The pET-24a(+) vector was inserted into the pET-24a(+) vector through the BseRI / Acul restriction site, and a plasmid with 24 repeating units as above was obtained by rolling circle plasmid construction.
[0093] Alanine A was selected as the X amino acid of the hydrophilic ELP block and the ELP of the control group. The amino acid repeating unit of the ELP (A) sequence was: (AGVPG), which was rep...
Embodiment 2
[0103] Example 2 IFNα-ELP obtained by culturing in Example 1 diblock Purified with IFNα-ELP(A) conjugate
[0104] 1. In this example, IFNα-ELP was purified by inverse transition cycling (Inverse transition cycling, ITC) diblock and IFNα-ELP (A). The specific method is as follows:
[0105] (1) Collect 1L of Escherichia coli culture solution in a centrifuge bottle, collect the cells by centrifugation at 3000×g, and remove the supernatant culture solution.
[0106] (2) The cells were resuspended in 30 mL of ice-cold PBS, and the cells were disrupted by an ultrasonic instrument at 4° C., and then the crushed E. coli products were centrifuged at 4° C. and 14,000×g centrifugal force for 15 minutes.
[0107] (3) Add 2 mL of polyethyleneimine (PEI, 10%) to the supernatant collected in step (2), and centrifuge again for 15 minutes, in order to remove nucleic acid and other negatively charged substances in the cell lysate, and obtain the above ITC purification of the supernatant: ad...
Embodiment 3
[0110] Example 3 Measurement of IFNα-ELP diblock and physicochemical characterization parameters of IFNα-ELP(A)
[0111] (1) Measure the molecular weight of the purified product obtained in Example 2 with matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF), the instrument used is 4800PlusMALDI-TOF / TOF TM Analyzer (AB SCIEX), the results are as image 3 shown, indicating that IFNα-ELP diblock , IFNα-ELP(A) and IFNα molecular weights are close to the theoretical values. That is, a purified protein sample with the correct molecular weight is obtained, which can be used for subsequent experiments.
[0112] (2)IFNα-ELP diblock The secondary structure of the sample is measured by circular dichroism analysis: the sample is diluted to 0.15 mg / mL with an aqueous solution, and the ultraviolet scanning analysis is carried out in the 200-250 nm wavelength range with Pistar π-180 (Applied Photophysics Co., Ltd.), and the results are as follows Fig...
PUM
Property | Measurement | Unit |
---|---|---|
Diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com