Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Improvement of rape pod shatter resistance by BnaA06FUL1 gene

An anti-crack angle and gene technology, applied in the direction of plant genetic improvement, genetic engineering, application, etc., can solve problems such as unclear specific functions

Active Publication Date: 2019-09-03
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the more complex allotetraploid rapeseed, there are more copies of the FUL gene, and the specific functions of the different homologous copies are not yet clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Improvement of rape pod shatter resistance by BnaA06FUL1 gene
  • Improvement of rape pod shatter resistance by BnaA06FUL1 gene
  • Improvement of rape pod shatter resistance by BnaA06FUL1 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Isolation and cloning of embodiment 1 gene

[0036] Take the roots, hypocotyls, cotyledons, stems, moss stems and leaves, flower buds, stigmas, stamens, sepals and siliques of Brassica napus Zhongshuang 11 (ZS11), add liquid nitrogen to grind, and take about 0.1g of powder into RNAase Add 1ml Trizol reagent (Treasure Bioengineering Dalian Co., Ltd.) to a free centrifuge tube, mix well and let stand at room temperature for 5 minutes, then add 200μl of chloroform, shake vigorously for 30 times, let stand until the liquid phase is separated, and centrifuge at 12000rpm at 4°C After 15 minutes, pipette about 500 μl of the supernatant into a new centrifuge tube, add an equal volume of isopropanol, place at room temperature for 15 minutes, centrifuge at 10,000 rpm at 4°C for 10 minutes, discard the supernatant, wash once with 75% ethanol, and blow dry Then add DEPC water to dissolve to obtain RNA samples; at the same time, take the silique samples of Brassica napus R1 and R2, ...

Embodiment 2

[0037] The construction of embodiment 2 transformation vectors

[0038] The CDS fragment of rapeseed BnaA06FUL1 gene was cloned with a primer with restriction endonuclease BamHI (A6FUL1F2: GGATCCATGGGAAGGGGTAGGGTTCA reverse primer A6FUL1R2: GGATCCCTATTCATTCGTCGTAGGGC), digested with restriction endonuclease BamHI, then electrophoresed on agarose gel, and then agarose The gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.) recovered the fragment. Digest the plant overexpression vector PBI121 with the restriction endonuclease BamHI, add the dephosphorylase SAP to dephosphorylate, use the agarose gel recovery kit to recover the vector fragment, and use the DNA T4 ligase ligation. Transform Escherichia coli competent cells DH5α by heat shock method, add the ligation product to the competent cells, place on ice for 30 minutes, bathe in water at 42°C for 90 seconds, add 400 μl of LB liquid medium, recover on a shaker at 37°C for 30 minutes, and coat the cells afte...

Embodiment 3

[0039] Embodiment 3 Utilize transformation vector to transform Agrobacterium tumefaciens

[0040] Take 1 μl of rapeseed BnaA06FUL1 gene overexpression vector plasmid DNA and add it to 50 μl of GV3101 competent cells, bathe in ice for 30 minutes, add liquid nitrogen to quickly freeze for 5 minutes, bathe in water at 37°C for 5 minutes, add 500 μl of LB liquid medium, and centrifuge the cells Spread on a YEP plate containing 50 mg / L kanamycin, 25 mg / L rifampicin and 25 mg / L streptomycin, and culture at 28°C for 2 days. Pick a single colony of Agrobacterium that is positive in the identification result, inoculate it into the YEP culture solution containing the above-mentioned concentration of antibiotics, and culture it on a shaker at 200 rpm at 28°C for 16 hours, so that the Agrobacterium can be cultivated to the logarithmic phase. Liquid MS (MS basal medium see: Murashige and Skoog, literature published in 1962, MS basal medium is common knowledge in this field) culture medium ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant genetic engineering, and in particular, relates to improvement of rape pod shatter resistance by a BnaA06FUL1 gene. The tissue expression of the BnaA06FUL1 gene in brassica napus and differential expression conditions of pod shatter-resistant and easy-to-pod shattered materials are analyzed. The brassica napus is transformed by construction ofa plant transformation vector and overexpressing of the BnaA06FUL1 gene, the pod shatter resistance of the brassica napus is improved, but other characters are not affected. The nucleotide sequence ofthe cloned BnaA06.FUL1 is shown in SEQ:ID NO:1. With brassica napus as a receptor, a transgenic plant overexpressing the brassica napus BnaA06FUL1 gene and having the pod shatter resistance characteris obtained by the agrobacterium-mediated transformation method. The BnaA06FUL1 gene can be used for improving pod shatter resistance ability of crops, especially brassica napus.

Description

technical field [0001] The invention belongs to the technical field of plant transgenics, and in particular relates to a method for improving rapeseed horn-cleavage resistance by using the BnaA06FUL1 gene. Background technique [0002] Rapeseed is the largest source of vegetable oil in my country. Rapeseed oil accounts for 55% of domestic vegetable oil production. my country is also a major producer of rapeseed in the world, with total output accounting for about 20% of the world (Hu et al., 2017). Increasing the planting area of ​​rapeseed and increasing the yield of rapeseed are of great significance to ensure the security of edible vegetable oil supply in my country. However, due to the low degree of mechanization in rapeseed production and the continuous increase in labor costs, the benefits of rapeseed planting have gradually declined, seriously affecting the development of rapeseed production. The easy cracking of rapeseed pods is currently the bottleneck restricting ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/00A01H6/20
CPCC07K14/415C12N15/8261
Inventor 胡琼成洪涛郝梦宇丁炳莉梅德圣汪文祥刘佳王会周日金
Owner INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com