Application of histone H2B mono-ubiquitination for identifying homologous recombination repair defects

A homologous recombination, monoubiquitin technology, applied in biochemical equipment and methods, microbial determination/inspection, instruments, etc., can solve the problem of difficulty in judging BRCA1/BRCA2 function loss, inability to guide the use of targeted drugs, homologous recombination The clinical diagnosis of defects and other problems are complicated, so as to achieve the advantages of good clinical economics and facilitate clinical operation.

Pending Publication Date: 2019-09-10
THE WEST CHINA SECOND UNIV HOSPITAL OF SICHUAN +1
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, a large number of clinical studies on breast and ovarian cancer have shown that detection of BRCA1 / BRCA2 gene mutations can only detect ~60% of tumors with homologous recombination repair deficiency (see: HRDetect is apredictor of BRCA1and BRCA2deficiency based on mutational signatures.NatMed.2017.3(4):517-525.), the remaining 40% of undetected homologous recombination-deficient tumors may have other genetic factors that affect homologous recombination repair, such as BRCA1 / BRAC2 gene promoter A Kylation abnormalities, gene splicing mutants, other gene mutations (such as ATM, RAD51, MRE11 or unknown mutations, etc.)
Furthermore, since there are no mutation hotspots in the BRCA1 / BRCA2 gene, a large number of VUS (a variant of unknown significance) mutations of unknown biological significance appear in clinical mutation detection (see: Scherr CL.etl.A preliminary investigation of genetic counselors'information needs when receiving a variant of uncertainty result: a mixed methods study.Genet Med.2015.17(9):739-46), it is difficult to judge whether it really leads to the loss of function of BRCA1 / BRCA2
Due to the existence of such VUS mutations, it is difficult to diagnose homologous recombination repair defects in a considerable part of tumors, and it is impossible to guide the use of targeted drugs in these tumors. Significant obstacle that further complicates the clinical diagnosis of homologous recombination deficiency
[0005] It can be seen that the current clinical use of BRCA1 / BRCA2 gene detection to diagnose homologous recombination repair-deficient tumors has obvious technical defects and application limitations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of histone H2B mono-ubiquitination for identifying homologous recombination repair defects
  • Application of histone H2B mono-ubiquitination for identifying homologous recombination repair defects
  • Application of histone H2B mono-ubiquitination for identifying homologous recombination repair defects

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1. H2B monoubiquitination mutant reduces homologous recombination repair efficiency

[0044] Experimental method: Inoculate HL-L02 cells into a 6cm culture dish, culture at 37°C until the cell coverage reaches 50-70%, transfect pLVX-Green-H2BK120RK125R(2KR), pLVX-Green-HBx and control plasmid pLVX-Green , after continuing to culture for 24 hours, transfect the I-SCE-I-HR plasmid, and use the I-SCE-I system to detect the efficiency of homologous recombination in vivo: collect the cells after 24 hours, and pass the High Pure PCR Template Preparation kit (Roche, 11796828001) Genomic DNA was extracted from cells, and primers for detecting HR efficiency were designed (primer sequence F: TGACCACCCCTGACCTACG; R: CACCTTGATGCCGTTCTTCTGC), and real-time fluorescent quantitative PCR was used to identify the effect of H2B monoubiquitin mutants on homologous recombination in vivo.

[0045] Experimental results: This experiment uses the I-SceI-GFP system (Development of Novel...

Embodiment 2

[0047] Example 2. H2B monoubiquitination mutants cause massive chromosomal breaks

[0048]Experimental method: The H2B monoubiquitination mutant cell line HL-L02 / 2KR and the control cell HL-L02 / pLVX were constructed using a lentiviral infection system. The constructed cells were inoculated into two 6cm-diameter culture dishes and cultured overnight. Eight hours after X-ray treatment (dose of 4Gy), colchicine (final concentration 200ng / ml) was added for 1.5 hours. Trypsinized, washed with PBS. Remove the supernatant and add 250 μl PBS to resuspend the cells. Add 6ml of 37°C preheated 75mM KCl dropwise. Incubate at 37°C for 25 minutes. Add 200 μl fixative (methanol: glacial acetic acid = 3:1) dropwise, mix gently, and centrifuge at 1000 rpm for 10 minutes. Add 5ml of fixative, mix well, and let stand at 4°C for 20 minutes. Centrifuge at 1000rpm for 10 minutes, and resuspend the cells in 50ul of fixative. Repeatedly fix the cells 3 times, and finally add 500 μl of fixative...

Embodiment 3

[0051] Example 3. Deficiency in homologous recombination repair leads to reduced H2B monoubiquitination levels

[0052] Experimental method: Small interfering RNA (siRNA) was used to silence homologous recombination repair genes such as BRCA1, BRCA2, WDR70, CTIP, MRE11, NBS1 and RAD51 in HL-L02 cells, random siRNA (Scramble) was used as the experimental control, and pLVX- Green-HBx plasmid. siRNA or HBx plasmid was transfected and silenced for 48 hours, then irradiated with ion rays (dose 10Gy), 4 hours later the total protein was extracted, and the H2B monoubiquitination level in the cells was detected by immunoblotting.

[0053] Experimental results: BRCA1, BRCA2, WDR70, CTIP,

[0054] The silencing of homologous recombination repair genes such as SMARCAD1, MRE11, NBS1 and RAD51 and the expression of the oncogene HBx all resulted in a decrease in the level of H2B monoubiquitination.

[0055] Conclusion: The results indicate that the functional abnormality of key components...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an application of histone H2B based mono-ubiquitination for detecting homologous recombination repair defects, in particular to a kit for detecting homologous recombination repair defects based on histone H2B mono-ubiquitination level and an application thereof. The application is to detect the defect of homologous recombination repair by detecting the histone H2B mono-ubiquitination level, and the result contributes to distinguishing the progress of related diseases and the responsiveness of homologous recombination targeted drug therapy such as PARP inhibitor and thelike, including but not limited to liver tissues or liver cancer with hepatitis B virus, and various tumors with homologous recombination gene mutation, expression and splicing body abnormality.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a method for detecting homologous recombination repair defects based on histone H2B monoubiquitination, and more specifically relates to a method for detecting homologous recombination repair defects based on histone H2B monoubiquitination levels The kit and its use are related. Specifically, the present invention relates to determining whether the tested sample has a defect in homologous recombination repair function by detecting the monoubiquitination (uH2B) level of histone H2B; the detected homologous recombination repair defect may be due to any regulatory homologous recombination Gene mutation or dysfunction of the repair mechanism (such as HBx expression, mutation of homologous recombination repair genes such as BRCA1 / BRCA2, splice body variation or abnormal gene expression, etc.), this detection method is a kind of detection method for homologous recombination repair...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/574C12Q1/6886C12Q1/6883
CPCG01N33/574C12Q1/6886C12Q1/6883C12Q2600/158
Inventor曾鸣陈杰王思张臣良唐子执王小军刘聪任来峰
OwnerTHE WEST CHINA SECOND UNIV HOSPITAL OF SICHUAN