Escherichia coli strain reformed by gene engineering, and applications thereof
A technology of engineering bacteria and genes, applied in the field of genetic engineering, can solve the problems that there is no method for preventing and controlling the fungus of the smut fungus, and achieve the effects of improving plant defense ability, obvious control effect, and simple cultivation conditions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] The inhibitory effect of embodiment 1 methyl jasmonate on the growth of two kinds of smut mycelia
[0047] 1. Experimental method
[0048] 1. Preparation of sugarcane whip smut bacteria liquid and maize smut bacteria liquid
[0049] Take the strains of Ustilago cane whip (WT17, WT18) and Ustilago maize (U9, U10) stored at -80°C on YEPSA plates, culture them at 28°C for 2-3 days, then scrape colonies at 28°C and 200rpm Shake the bacteria and set aside.
[0050] 2. The final concentration of methyl jasmonate was added to YEPS to be 200 μM, and the control group was set without methyl jasmonate, and Ustilago sativa was cultured on the plate at 28°C for three days, and the experimental results were observed. The final concentration of methyl jasmonate was added to YEPS-c to be 400 μM, and the control group without methyl jasmonate was set. Ustilago zea was cultured on a plate at 28°C for three days, and the experimental results were observed.
[0051] 2. Experimental res...
Embodiment 2
[0053] Example 2 Construction of Engineering Bacteria Expressing Plant Source Jasmonic Acid Methyltransferase Gene
[0054] 1. Experimental method
[0055] 1. Construction of jasmonate methyltransferase (JMT) expression vector
[0056] The jasmonate methyltransferase gene sequence (shown in its nucleotide sequence as SEQ ID NO: 1) was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd., and enzyme cutting sites EcoRI and SalI were added to the left and right ends respectively, Its nucleotide sequence is as follows (the underlined part is the enzyme cutting site):
[0057] gaattcatggaggtaatgcgagttcttcacatgaacaaaggaaacggggaaacaagttatgccaagaactccaccgctcagagcaacataatatctctaggcagaagagtaatggacgaggccttgaagaagttaatgatgagcaattcagagatttcgagcattggaatcgccgacttaggctgctcctccggtccgaacagtctcttgtccatctccaacatagttgacacgatccacaacttgtgtcctgacctcgaccgtccagtccctgagctcagagtctctctcaacgacctccctagcaatgacttcaactacatatgtgcttctttgccagagttttacgaccgggttaataataacaaggagggtttagggttcggtcgtggaggaggagaatcg...
Embodiment 3
[0066] Embodiment 3 confrontation culture method measures methyl jasmonate and Escherichia coli E-pJMT activity
[0067] 1. Preparation of sugarcane whip smut and maize smut bacteria
[0068] Take the strains of Ustilago cane whip and Ustilago maize stored at -80°C and spot them on the YEPSA plate, culture them at 28°C for 2-3 days, then scrape the colonies and shake them at 28°C at 200rpm for later use.
[0069] 2. Preparation of E-pJMT engineering bacteria solution
[0070] Streak the E-pJMT engineered bacteria stored at -80°C on the LB plate, culture it at 37°C for 1 day, pick a single colony and shake it in the LB liquid medium at 37°C at 200rpm, and set aside.
[0071] 3. Heterologous expression of E-pJMT engineering bacteria
[0072] Take the E-pJMT engineered bacteria that were shaken overnight in 50mL LB medium containing kanamycin, shake the bacteria at 200rpm at 37°C, and wait until the bacterial solution OD 600 = 1.0, add IPTG (Isopropylβ-D-Thiogalactoside) with ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap