Escherichia coli strain reformed by gene engineering, and applications thereof

A technology of engineering bacteria and genes, applied in the field of genetic engineering, can solve the problems that there is no method for preventing and controlling the fungus of the smut fungus, and achieve the effects of improving plant defense ability, obvious control effect, and simple cultivation conditions

Active Publication Date: 2019-10-22
SOUTH CHINA AGRI UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Currently there is no safe and effective biocontrol method for the control of smut fungi

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Escherichia coli strain reformed by gene engineering, and applications thereof
  • Escherichia coli strain reformed by gene engineering, and applications thereof
  • Escherichia coli strain reformed by gene engineering, and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] The inhibitory effect of embodiment 1 methyl jasmonate on the growth of two kinds of smut mycelia

[0047] 1. Experimental method

[0048] 1. Preparation of sugarcane whip smut bacteria liquid and maize smut bacteria liquid

[0049] Take the strains of Ustilago cane whip (WT17, WT18) and Ustilago maize (U9, U10) stored at -80°C on YEPSA plates, culture them at 28°C for 2-3 days, then scrape colonies at 28°C and 200rpm Shake the bacteria and set aside.

[0050] 2. The final concentration of methyl jasmonate was added to YEPS to be 200 μM, and the control group was set without methyl jasmonate, and Ustilago sativa was cultured on the plate at 28°C for three days, and the experimental results were observed. The final concentration of methyl jasmonate was added to YEPS-c to be 400 μM, and the control group without methyl jasmonate was set. Ustilago zea was cultured on a plate at 28°C for three days, and the experimental results were observed.

[0051] 2. Experimental res...

Embodiment 2

[0053] Example 2 Construction of Engineering Bacteria Expressing Plant Source Jasmonic Acid Methyltransferase Gene

[0054] 1. Experimental method

[0055] 1. Construction of jasmonate methyltransferase (JMT) expression vector

[0056] The jasmonate methyltransferase gene sequence (shown in its nucleotide sequence as SEQ ID NO: 1) was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd., and enzyme cutting sites EcoRI and SalI were added to the left and right ends respectively, Its nucleotide sequence is as follows (the underlined part is the enzyme cutting site):

[0057] gaattcatggaggtaatgcgagttcttcacatgaacaaaggaaacggggaaacaagttatgccaagaactccaccgctcagagcaacataatatctctaggcagaagagtaatggacgaggccttgaagaagttaatgatgagcaattcagagatttcgagcattggaatcgccgacttaggctgctcctccggtccgaacagtctcttgtccatctccaacatagttgacacgatccacaacttgtgtcctgacctcgaccgtccagtccctgagctcagagtctctctcaacgacctccctagcaatgacttcaactacatatgtgcttctttgccagagttttacgaccgggttaataataacaaggagggtttagggttcggtcgtggaggaggagaatcg...

Embodiment 3

[0066] Embodiment 3 confrontation culture method measures methyl jasmonate and Escherichia coli E-pJMT activity

[0067] 1. Preparation of sugarcane whip smut and maize smut bacteria

[0068] Take the strains of Ustilago cane whip and Ustilago maize stored at -80°C and spot them on the YEPSA plate, culture them at 28°C for 2-3 days, then scrape the colonies and shake them at 28°C at 200rpm for later use.

[0069] 2. Preparation of E-pJMT engineering bacteria solution

[0070] Streak the E-pJMT engineered bacteria stored at -80°C on the LB plate, culture it at 37°C for 1 day, pick a single colony and shake it in the LB liquid medium at 37°C at 200rpm, and set aside.

[0071] 3. Heterologous expression of E-pJMT engineering bacteria

[0072] Take the E-pJMT engineered bacteria that were shaken overnight in 50mL LB medium containing kanamycin, shake the bacteria at 200rpm at 37°C, and wait until the bacterial solution OD 600 = 1.0, add IPTG (Isopropylβ-D-Thiogalactoside) with ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Escherichia coli strain reformed by gene engineering, and applications thereof. According to the present invention, engineering bacteria for preventing and controlling smutis constructed by using the applications of methyl jasmonate in prevention and controlling of smut, and recipient bacteria over-express methyl jasmonate transferase; the metabolite of the engineeringbacteria is methyl jasmonate, such that the biosafety problem does not exist; jasmonate methyltransferase is derived from plants, and cannot cause biosafety problem after being expressed by Escherichia coli; the engineering bacteria are Escherichia coli, and has characteristics of simple culture conditions, low cost and simple implementation method; the method for improving the defense ability byincreasing the content of the hormone methyl jasmonate in the plant does not affect the growth of the plant; and with the application of the engineering bacteria in prevention and controlling of CornLump Smut, the significant prevention and control effect can be achieved, and the Escherichia coli strain reformed by gene engineering is worthy of being popularized and applied.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, and more specifically relates to a genetically engineered Escherichia coli strain and an application thereof. Background technique [0002] For a long time before the emergence of biological control diseases, plant disease control was mainly based on chemical control. The trend of pesticide control is that high efficiency means high toxicity, so it is very urgent to find high-efficiency, low-toxic or even non-toxic disease control methods. Biological control of diseases is one of the safest methods to solve chemical control with high efficiency and high toxicity. [0003] Isolating microorganisms that have antagonistic effects on pathogenic bacteria from different environments is currently the main screening method for biocontrol bacteria. However, the change of the original environment is also a challenge to the living conditions of microorganisms. The colonization of the new envir...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A01N37/42A01N43/16A01P3/00C12N1/21C12N15/54C12N15/70C12R1/19
CPCA01N37/42A01N43/16C12N9/1007C12N15/70
Inventor邓懿祯崔国兵尹凯黄成玮罗利蓉
OwnerSOUTH CHINA AGRI UNIV