Recombinant lipase mutant, coding gene, recombinant engineering bacterium and application

A technology of genetically engineered bacteria and encoded genes, applied in recombinant lipase mutants, encoded genes, recombinant engineered bacteria and application fields, can solve the problems of long reaction time, low concentration of split reaction substrates, low catalytic activity of lipase, etc. , to achieve the effect of short reaction time, less catalyst dosage and high substrate concentration

Active Publication Date: 2019-10-22
ZHEJIANG UNIV OF TECH
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The mutant has higher substrate tolerance and higher catalytic activity to racemic N-acetyl-piperidine-2,3-dicarboxylic acid dimethyl ester, which can effectively solve the current lipase catalytic activity. Low, low substrate concentration in the resolution reaction, long reaction time and other issues, greatly improving the catalytic efficiency, reducing the industrial production cycle and reducing production costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant lipase mutant, coding gene, recombinant engineering bacterium and application
  • Recombinant lipase mutant, coding gene, recombinant engineering bacterium and application
  • Recombinant lipase mutant, coding gene, recombinant engineering bacterium and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: Construction of recombinant lipase genetically engineered bacteria E.coli Rosetta(DE3) / pET22b-SRL

[0032] The gene sequence of Sporisorium reilianum SRZ2 lipase (SRL) was optimized by yeast codons, and the pGEM-T-SRL plasmid was obtained by total gene synthesis. Design homologous recombination primer 1 (GCGATGGCCACTCCATTGGTTAAGAGA), primer 2 (GTGGTGGTGCAAGATAACACCAGAACA), primer 3 (GTTATCTTGCACCACCACCACCACCAC), primer 4 (CAATGGAGTGGCCATCGCCGGCTGGGC), using Max Super-Fidelity DNA polymerase is amplified with pGEM-T-SRL and pET22b plasmid as template, obtains the lipase gene sequence of 966bp (nucleotide sequence as shown in SEQ ID NO.1, aminoacid sequence SEQ ID NO.2 Shown) and the pET22b expression vector gene sequence of 5427bp. A one-step cloning kit was used to connect the lipase gene fragment with the pET22b expression vector gene fragment to construct the expression vector pET22b-SRL. The constructed recombinant expression vector was transformed in...

Embodiment 2

[0033] Example 2: Rational design and construction of recombinant lipase mutant mut-Ile194Lys

[0034] Using the recombinant bacteria (E.coli Rosetta(DE3) / pET22b-SRL) containing the expression vector pET22b-SRL as the starting strain, a mutation was introduced at the 194th position of the amino acid sequence of SRL by site-directed mutagenesis (the amino acid shown in SEQ IN NO.2 The 194-position Ile of the sequence is mutated to Lys), which improves the catalytic activity of lipase to the substrate racemic N-acetyl-piperidine-2,3-dicarboxylic acid dimethyl ester. Design primers for site-directed mutagenesis as follows:

[0035] Ile194Lys:

[0036] Upstream primer 5: 5'-CTCTGCTACTGACGACAAGGTTCAACCACAAAAC-3'

[0037] Downstream primer 6: 5'-GTTTGTGGTTGAACCTTGTCGTCAGTAGCAGAG-3'

[0038] Using the pET22b-SRL plasmid as a template, mutations were introduced by PCR. The PCR reaction procedure was as follows: 95°C for 3 min; 95°C for 15 s, 58°C for 15 s, 72°C for 6 min, repeating...

Embodiment 3

[0040] Embodiment 3: Continued transformation and screening of recombinant lipase mutant mut-Ile194Lys

[0041] Using the mutant mut-Ile194Lys as the starting strain, the catalytic activity of lipase to the substrate racemic N-acetyl-piperidine-2,3-dicarboxylate dimethyl was further improved by site-directed saturation mutagenesis. Primers were designed as follows:

[0042] Leu(L)145:

[0043] Upstream primer 7:

[0044] 5'-ACTACAAGGGTACTGTTNNKGCTGCTTTCTTGACTAC-3'

[0045] Downstream primer 8:

[0046] 5'-GTAGTCAAGAAAGCAGCMNNAACAGTACCCTTGTAGT-3'

[0047] Ala(A)146:

[0048] Upstream primer 9:

[0049] 5'-ACAAGGGTACTGTTTTGNNKGCTTTCTTGACTACTCC-3'

[0050] Downstream primer 10:

[0051] 5'-GGAGTAGTCAAAGAAAGCMNNCAAAACAGTACCCTTGT-3'

[0052] Leu(L)149:

[0053] Upstream primer 11:

[0054] 5'-CTGTTTTGGCTGCTTTCNNKACTACTCCAGGTTTGGC-3'

[0055] Downstream primer 12:

[0056] 5'-GCCAAACCTGGAGTAGTMNNGAAAGCAGCCAAAACAG-3'

[0057] Leu / Ser(L / S)154 / 156 combination:

[0058] U...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant lipase mutant, a gene, a vector, an engineering bacterium and application of the mutant. The mutant is obtained in the mode that sporisorium reilianum SRZ2lipase(SRL) as a start is mutated. The lipase mutant is obtained in the mode that the 145 and 194 loci of the amino acid sequence shown in SEQ ID NO.2 are subjected to single mutation or combined mutation. Compared with a wild enzyme, the catalytic activity and substrate tolerance of the mutant during reaction conversion are greatly improved, and the consumed time in the reaction process is obviously shortened. Compared with (S,S)-2,8-diazabicyclo[4,3,0]nonane prepared through a chemical method, the product obtained through the technology is high in stereoselectivity, the reaction conditionsare milder, the requirements for the equipment are low, the reaction cost is lowered, and the product is environmentally friendly.

Description

[0001] (1) Technical field [0002] The present invention relates to a recombinant lipase mutant and its encoding gene, as well as a recombinant vector containing the mutant encoding gene, a recombinant genetically engineered bacterium containing the mutant encoding gene, and the preparation of the lipase mutant of Mycosporum smut lipase Application of (2S,3R)-N-acetyl-piperidine-2,3-dicarboxylic acid dimethyl ester. [0003] (2) Background technology [0004] Lipase (Lipase, EC3.1.1.3), the system name is triacylglycerol acylhydrolase (triacylglycerol acylhydrolase), which can catalyze a series of reactions such as hydrolysis, esterification, transesterification, alcoholysis, acidolysis, and ammonolysis. Biocatalysts are the most recognized class of biocatalysts in biotechnology. The versatility of lipases makes them ideal for use in various industries such as food, pharmaceuticals, detergents, leather, textiles, cosmetics and paper. Lipase widely exists in organisms such as...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/20C12N15/55C12N15/70C12N1/21C12P41/00C12P17/12C12R1/19
CPCC12N9/20C12P17/12C12P41/001C12Y301/01003
Inventor柳志强沈江伟齐凤玉张晓健郑裕国
OwnerZHEJIANG UNIV OF TECH