Method for inhibiting production of yeast pre-flocculating factor

A yeast and inhibitor technology, which is applied in the field of inhibiting the production of yeast in advance of flocculation factors, can solve the problems of unreported cloning, expression and application, and little research on HVXI.

Inactive Publication Date: 2019-10-22
YANCHENG INST OF TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0014] So far, there are few studies on HVXI, and there

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for inhibiting production of yeast pre-flocculating factor
  • Method for inhibiting production of yeast pre-flocculating factor
  • Method for inhibiting production of yeast pre-flocculating factor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Step 1: HVXI gene synthesis. The G+C content of the HVXI gene (GenBank: AJ581529.1) is as high as 72.6%. In order to facilitate the synthesis operation, some bases in codons are optimized, as shown in SEQ ID NO: 1.

[0048] Step 2: Construction of Pichia pastoris cloning vector and expression vector according to the technical solution. The codon-optimized HVXI gene was amplified by primers, and the amplified gene sequence was double digested by EcoR I and Xba I, and then inserted into the pGAPZαA vector to construct a constitutive GAP expression vector;

[0049] Among them, the upstream primer: SEQ ID NO: 3

[0050] Downstream primer: TTTTCTAAAAGTTCAAGTTGCC, SEQ ID NO: 4;

[0051] The Pichia pastoris plasmid:

[0052] pGAPZαA-HVXI(EcoRI)+: AATGAATTC GGGTGCTCCTCCTCG;

[0053] pGAPZαA-HVXI(XbaI)-: ACATCTAGATTCTAAAAGTTCAAGTTGCCGC.

[0054] Step 3 according to the technical solution: transformation of Pichia pastoris and expression of the target protein. The con...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention first discloses a codon-optimized gene of a xylanase inhibitor and then discloses an amino acid sequence of the xylanase inhibitor and an expression vector of the xylanase inhibitor. Anexpressing method of the xylanse inhibitor is also disclosed, a separation and purification method of the xylanase inhibitor is further disclosed, and finally a method for inhibiting the production ofa yeast pre-flocculating factor by using the xylanase inhibitor is disclosed. An HVXI gene is expressed in pichia pastoris X33 through a GAP promoter, a transformant having the highest activity is screened by inhibiting the endo-xylanase activity, preliminary separation and purification conditions are determined, the application in a saccharification process is explored, the inhibitory effect onPYF is studied, and a feasible way is provided for further applying the xylanase inhibitor to field barley or a wheat production process to reduce the production of the PYF in the barley or malt.

Description

technical field [0001] The invention belongs to the field of microbial fermentation, and in particular relates to a method for inhibiting the production of yeast in advance of flocculation factors. Background technique [0002] China is a big country in beer production and consumption. In 2018, my country's beer output reached 38.122 million kiloliters, and its sales revenue exceeded 160 billion yuan. It is an important part of the food industry. Yeast is the foundation and soul of beer brewing, affecting the stability of beer production process and beer quality. At the end of the normal fermentation of beer, yeast will gradually aggregate from a suspended state into a mass, and then settle naturally, that is, yeast flocculation. Premature Yeast Flocculation (PYF) refers to the fact that during the fermentation process of beer, the yeast has not completely fermented the available fermentable sugar, and a large amount of sedimentation occurs. At the same time, it is easy to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/29C12N15/81C07K14/415C07K1/16C12C5/02
CPCC07K14/415C12N15/815C12C5/004C12C5/02C12N2800/22
Inventor 商曰玲王笃军陆健李凤伟余晓红缪胜阿比得欣宇张梓涵
Owner YANCHENG INST OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap