Method for inhibiting production of yeast pre-flocculating factor
A yeast and inhibitor technology, which is applied in the field of inhibiting the production of yeast in advance of flocculation factors, can solve the problems of unreported cloning, expression and application, and little research on HVXI.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Step 1: HVXI gene synthesis. The G+C content of the HVXI gene (GenBank: AJ581529.1) is as high as 72.6%. In order to facilitate the synthesis operation, some bases in codons are optimized, as shown in SEQ ID NO: 1.
[0048] Step 2: Construction of Pichia pastoris cloning vector and expression vector according to the technical solution. The codon-optimized HVXI gene was amplified by primers, and the amplified gene sequence was double digested by EcoR I and Xba I, and then inserted into the pGAPZαA vector to construct a constitutive GAP expression vector;
[0049] Among them, the upstream primer: SEQ ID NO: 3
[0050] Downstream primer: TTTTCTAAAAGTTCAAGTTGCC, SEQ ID NO: 4;
[0051] The Pichia pastoris plasmid:
[0052] pGAPZαA-HVXI(EcoRI)+: AATGAATTC GGGTGCTCCTCCTCG;
[0053] pGAPZαA-HVXI(XbaI)-: ACATCTAGATTCTAAAAGTTCAAGTTGCCGC.
[0054] Step 3 according to the technical solution: transformation of Pichia pastoris and expression of the target protein. The con...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com