An acid-resistant bacterial strain with high yield of bacterial cellulose and method for producing bacterial cellulose
A technology of bacterial cellulose and production method, applied in the field of microorganisms, can solve the problems of easy contamination, low yield and high nutritional requirements, and achieve the effects of high conversion rate, reduction of production cost and improvement of production efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] The screening of embodiment 1 bacterial cellulose producing bacteria
[0040] The present invention obtains bacterial cellulose high-yielding acid-resistant bacterial strain ATC301 through a large amount of screening and separation from vinegar fermented grains, and the specific method of each screening comprises the following steps:
[0041] (1) Take 2 g of fresh vinegar unstrained spirits, add 5 mL of sterile water, and mix well to prepare vinegar unstrained spirits suspension;
[0042] (2) Take 1 mL of the suspension and add it to a 250 mL Erlenmeyer flask containing 49 mL of liquid screening medium (20 g / L glucose, 10 g / L ethanol, 20 g / L corn steep liquor, 1 g / L magnesium sulfate heptahydrate, pH 5.0), Incubate at 30°C for 3 days until a translucent film is formed on the surface of the culture medium;
[0043](3) Rinse the translucent membrane twice with sterile water, transfer to a 50mL sterile centrifuge tube, add 10mL sterile water, add sterile glass beads, Vort...
Embodiment 2
[0050] 16S rDNA Identification of Example 2 Strain ATC301
[0051] Utilizing conventional PCR technology, primers 27F (AGAGTTTGATCCTGGCTC AG) and 1492R (TACGGCTACCTTGTTACGACTT) were used as primer pairs, and the bacterial solution of strain ATC301 was used as a template to carry out PCR amplification. It was detected by agarose gel electrophoresis that 1 pact of 1.4 kb DNA fragments. The PCR reaction system and conditions are shown in Table 1:
[0052] Table 1 PCR amplification reaction system and conditions of 16S rDNA
[0053]
[0054] Using the agarose gel recovery kit, operate according to the instructions, recover the above 1.4kb DNA fragment, then perform sequencing, remove the low-quality sequences at both ends, and obtain the 16S rDNA sequence of strain ATC301 as shown in SEQ ID NO.1 (full 1345bp long).
[0055] The sequence of 16S rDNA shown in SEQ ID NO.1 was BLASTed on NCBI, the result is as follows figure 1 As shown, the 16S rDNA sequence of the ATC301 strai...
Embodiment 3
[0056] Embodiment 3 ATC301 bacterial strain produces the shaking flask fermentation experiment of bacterial cellulose (1)
[0057] In this example, the Komagataeibacter sp.ATC301 strain is investigated under acidic conditions (pH 5.0), using cheap and easy-to-obtain fermentation raw materials (glucose, sucrose, corn steep liquor, etc.), and fermenting and producing bacterial fiber in a shake flask in a dynamic culture mode. The performance of the element, the specific method is as follows:
[0058] (1) Activate the ATC301 strain on a fresh plate: Streak the ATC301 strain preserved in glycerin onto a freshly prepared plate (10g / L peptone, 5g / L yeast powder, 5g / L glucose, 0.5g / L magnesium sulfate heptahydrate, pH 7.0 ), invert the plate and incubate at 30°C for 2-3 days until colonies grow out.
[0059] (2) Preparation of shake flask seeds: use an inoculation loop to pick 2 rings of bacteria from the activation plate obtained in step (1) and inoculate them into 20mL seed medium...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More