High-reactivity cell strain for detecting biologic activity of recombinant human epidermal growth factors

A technology of epidermal growth factor and biological activity, applied in cells modified by the introduction of foreign genetic material, biochemical equipment and methods, biological testing, etc. problem, to achieve the effect of low effective concentration, high accuracy and high application value

Active Publication Date: 2019-11-26
NAT INST FOR FOOD & DRUG CONTROL
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the commonly used activity determination method is the NIH3T3 cell proliferation method, but the NIH3T3 cells have poor reactivity to rhEGF, resulting in a high effective concentration; the experimental results are highly variable; the experimental period is 6 days

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-reactivity cell strain for detecting biologic activity of recombinant human epidermal growth factors
  • High-reactivity cell strain for detecting biologic activity of recombinant human epidermal growth factors
  • High-reactivity cell strain for detecting biologic activity of recombinant human epidermal growth factors

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0059] In the present invention, the Mouse CRISPR Knockout Pooled Library (GeCKO v2) is packaged as a lentiviral library (LentiCRISPR), and the library is used to infect NIH3T3 cells at an MOI value of 0.3, and then the single clones are sorted by flow cytometry and then induced with a low dose of rhEGF. The NIH3T3 cell line with better reactivity to rhEGF was screened out, and the corresponding detection method was established to quantify the activity of rhEGF. The technical process is: screening of NIH3T3 hyperresponsive cell lines (NIH3T3 cells infected with LentiCRISPR and induced with rhEGF) → establishment of rhEGF activity assay method and methodological verification.

[0060] 1. Materials and methods:

[0061] 1.1 Research object: recombinant human epidermal growth factor

[0062] 1.2 Mouse CRISPR Knockout Pooled Library (GeCKO v2) (#1000000052): purchased from Addgene.

[0063] NIH3T3 cells: purchased from ATCC.

[0064] rhEGF standard and samples: kept by the Reco...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
recovery rateaaaaaaaaaa
Login to View More

Abstract

The invention relates to a high-reactivity cell strain for detecting biologic activity of recombinant human epidermal growth factors. Original rhEGF is used for detecting a living cell NIH3T3, after some genes in cells are knocked out randomly, monoclones are selected, a cell strain NIH3T3-CRSPRV2(6) better in rhEGF reactivity is obtained, after an NIH3T3-CRISPRV2(6) cell strain is identified through bibasic sequencing and transcriptome thermography experiment, some knockout genes are Pcdhgb4 and H1fx, and gRNA is respectively ATAGTCTGTGTTTCACTACC and GCGCCCTCGCTAGGGCCCGA. Specific detection steps include that for NIH3T3-CRSPRV2(6), a 96-hole plate is paved by 6,000 / hole, hunger treatment is performed for 30min with PBS, analysis culture mediums containing series concentration of rhEGF areadded, action is performed for 48h, and cell activity is detected by an MTT method. According to the detection method disclosed by the invention, the operation time is shortened, the reaction is acute, the signal-noise ratio is high, serum interference is reduced, and the detection method has important significance in quality control and clinical application of rhEGF.

Description

Technical field: [0001] The invention relates to the field of biopharmaceutical activity detection. Aiming at the biological activity measurement of recombinant human epidermal growth factor (rhEGF), a cell line with high reactivity to rhEGF is screened out, and a faster and more accurate bioactivity measurement method is established. Background technique: [0002] Recombinant human epidermal growth factor (rhEGF) is a genetic engineering technology that transfers the human epidermal growth factor gene into mammalian cells, and highly expresses a polypeptide that can promote the growth of various epidermal tissues. It is used to treat burns and ulcers , All kinds of trauma and corneal injury. At present, the commonly used activity determination method is the NIH3T3 cell proliferation method, but the NIH3T3 cells have poor reactivity to rhEGF, resulting in a high effective concentration; the variability of the experimental results is large; the experimental period is 6 days. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/10C12N15/867G01N33/68G01N33/569
CPCC12N15/86G01N33/68G01N33/56966G01N2333/485Y02A50/30
Inventor王军志饶春明秦玺李山虎姚文荣史新昌刘兰贾春翠黄芳周勇段茂芹
OwnerNAT INST FOR FOOD & DRUG CONTROL