The invention relates to a high-reactivity
cell strain for detecting biologic activity of recombinant human epidermal growth factors. Original rhEGF is used for detecting a
living cell NIH3T3, after some genes in cells are knocked out randomly, monoclones are selected, a
cell strain NIH3T3-CRSPRV2(6) better in rhEGF reactivity is obtained, after an NIH3T3-CRISPRV2(6)
cell strain is identified through bibasic sequencing and
transcriptome thermography experiment, some knockout genes are Pcdhgb4 and H1fx, and gRNA is respectively ATAGTCTGTGTTTCACTACC and GCGCCCTCGCTAGGGCCCGA.
Specific detection steps include that for NIH3T3-CRSPRV2(6), a 96-hole plate is paved by 6,000 / hole, hunger treatment is performed for 30min with PBS, analysis
culture mediums containing series concentration of rhEGF areadded, action is performed for 48h, and
cell activity is detected by an
MTT method. According to the detection method disclosed by the invention, the
operation time is shortened, the reaction is acute, the
signal-
noise ratio is high, serum interference is reduced, and the detection method has important significance in
quality control and clinical application of rhEGF.