Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

38results about How to "The results are objective and reliable" patented technology

Music recommendation method, device and system

The embodiment of the invention provides a music recommendation method and device, an electronic device and a storage medium. The method specifically comprises the following steps: receiving video data and to-be-matched multi-segment music data, and inputting the video data and the music data into a pre-trained multi-modal matching network model for processing to obtain a video embedding vector ofthe video data and an audio embedding vector of each segment of music data; inputting the video embedding vector and the audio embedding vector into a pre-trained personalized sorting model for calculation to obtain a matching degree between the video data and each section of music data; and finally, outputting the music data of which the matching degree conforms to a preset standard as target music to be matched, so that the user can utilize the target music to carry out music matching on the video. The target music is obtained through objective calculation, and the result is objective and reliable, so that the matching degree between the dubbing music and the corresponding video work is effectively improved, and finally the satisfactory audio and video work is obtained.
Owner:BEIJING DAJIA INTERNET INFORMATION TECH CO LTD

Method for identifying low-temperature resistance of wild cotton in seedling stage

The invention belongs to plant physiology and particularly relates to a method for identifying low-temperature resistance of wild cotton in a seedling stage. The method comprises the following steps: 1) sulfuric acid delinting and incision treatment on seeds; 2) germination accelerating treatment; 3) seedling culture: common seedlings in a 3-5-leaf stage with consistent growth vigor are selected; 4) low-temperature stress treatment: low-temperature stress treatment closer to natural conditions is selected; 5) low-temperature resistance level classification: grading is performed according to damaged conditions of cotton seedlings, and resistance levels of the wild cotton are classified. According to the method, severe low-temperature stress treatment is performed in the seedling stage when the wild cotton is most sensitive to low temperature, so that a low-temperature-resistant cotton material truly with higher resistance level can be screened out; grading is performed according to damaged conditions of cotton leaves, objective classification is performed, and errors caused by human factors are reduced greatly. The method is not limited by seasons, can be used for identifying mass materials and is easy to popularize and use.
Owner:INST OF COTTON RES CHINESE ACAD OF AGRI SCI

Rat chills and fever approach behavior determinator

A rat cold-heat approach behavior measurer belongs to animal experiment instrument and equipment, and is mainly used in the research of the cold-heat constitution of a rat, a cold-heat tendency under a pathologic condition and the influence of traditional Chinese medicine cold-heat drug nature on the cold-heat tendency behavior of a rat so as to carry out a research in the four nature theory of traditional Chinese medicine. The invention is realized through adopting the following steps that: a heat case 1, a room temperature case 12 and a cold case 10 are arranged inside an integral case shell 15; the heat case and the cold case are respectively provided with a heating element inside, a cooling element, a temperature controller, a photoelectric switch, a time accumulation timer, a 220 V power supply and an AC / DC switching power supply; all circuits are arranged between the integral case shell on one hand and the heat case, the room temperature case and the cold case on the other hand; and one outer side wall of the integral case shell is provided with a control panel 9 so as to operate the entire measurer.
Owner:SHANDONG UNIV OF TRADITIONAL CHINESE MEDICINE

Ureaplasma urealyticum PCR (Polymerase Chain Reaction) detection kit and detection method thereof

The invention relates to the field of microorganism detection, in particular to an ureaplasma urealyticum PCR (Polymerase Chain Reaction) detection kit and a detection method thereof, aims to provide the ureaplasma urealyticum PCR detection kit and the detection method thereof for detecting a specific nucleic acid sequence of ureaplasma urealyticum in a clinical sample so as to fulfill the aim ofquickly judging the existence of the ureaplasma urealyticum. In order to fulfill the aim, the technical scheme is to provide the ureaplasma urealyticum PCR detection kit, which includes DNA (Deoxyribonucleic Acid) extract, PCR reaction solution, dNTPs, tap enzyme, UNG enzyme, positive control, negative control and a quantitative reference product, wherein the PCR reaction solution includes a primer A and a fluorescent probe A; and the primer is divided into an upstream primer A and a downstream primer A. The kit has the advantages of high flexibility and specificity, stability, timeliness, convenience in operation and the like.
Owner:泰普生物科学(中国)有限公司

RGA (Report Gene Assay) method for detecting biological activity of exendin-4-HAS Byetalog

The invention provides a novel biological activity determination method of exendin-4-HAS Byetalog. The basic principle of the method is that a GLP-1R (Glucagon-Like Peptide-1R) and a cAMP (cyclic Adenosine Monophosphate) response element (CER) report gene carrier are used for co-transfection of a CHO-K1 cell, and the steps of pressurization, sieving and monoclonal separation and cultivation are carried out to obtain a stable monoclonal cell strain CHOglplr / crec14. After the GLP-1R is combined with a ligand, a series of signal transduction is carried out to stimulate the expression of CRE reporter gene luciferase, and the activity of the Byetalog is quantified by detecting the change of the expression of the luciferase after the Byetalog stimulates. The specific detection steps are as follows: 6000 CHOglplr / crec14 cells are placed on each pore of a 96-pore plate to be cultured for 16-18 hours; the Byetalog with different concentrations is added to stimulate the cells for 6 hours; the activity of the luciferase is detected. The method is simple to operate, sensitive in reaction and small in variability, and has very important meaning to quality control and clinical application of the Byetalog.
Owner:NAT INST FOR FOOD & DRUG CONTROL

Method for identifying wine products

The invention relates to a method for identifying wine products, and belongs to the technical field of wine identification. Through combination of headspace solid-phase microextraction, liquid-liquidextraction, a full two-dimensional gas chromatography / time-of-flight mass spectrometry and a machine learning algorithm, Baijiu is used as model wine, a wine identifying method which does not rely oncharacteristic component analysis is established, and the method is used for analyzing different wine samples. By the method, individual compounds in an atlas are required to be analyzed, and categories, brands, strains, qualities, flavors, production places, years and the like of wines are accurately identified only based on raw data acquired by instrumental analysis and a recognition algorithm model; compared with the conventional method, the method provided by the invention has the advantages as follows: the method is simple and convenient, is independent of human experience, and is more objective and reliable and faster, and with increase in a sample library, more accurate identification can be achieved.
Owner:LUZHOU PINCHUANG TECH CO LTD +1

Heterophoria objective detection method and system

The invention provides a heterophoria objective detection method and system. Eye position real-time monitoring is adopted, the measurement process is simple, a detected person does not need to participate in adjustment, the detection result is objective, reliable and more credible, and the detection process is simple and fast.
Owner:CHANGCHUN UP OPTOTECH

Method for relieving corn deep sowing stress by applying exogenous brassinosterols

The invention provides a method for relieving corn deep sowing stress by applying exogenous brassinosteroid, and relates to the field of corn safety production guarantee, and the method comprises material collection, BR treatment liquid preparation, seed treatment, deep sowing stress test, determination item and determination method, optimal concentration application and result analysis. According to the method, the relieving effect of the BR on the deep sowing stress of the corn seedlings under different concentrations is evaluated, the effect of relieving the deep sowing stress of the corn seedlings by the exogenous BR is scientifically, objectively and comprehensively evaluated by adopting a membership function method, a theoretical foundation is laid for improving the deep sowing resistance of the corn, a technical reference is provided for rapid application of the exogenous BR and screening of the optimal concentration, and the method has a wide application prospect. The application prospect is wide.
Owner:GANSU AGRI UNIV

Testing instrument for cold-hot drink of large mouse

The invention relates to a rat cold hot drink preference determinator. The invention belongs to the animal experimental apparatus field and is mainly used for investigating whether a rat likes drinking hot water or cold water and providing an objective quantitative index, thereby investigating the cold or hot body state of the rat or investigating whether a pathological attribute during a disease is a hot property symptom or a cold property symptom. The invention is provided with a water bottle connected with a water outlet pipe, wherein the latter provides drinking water for the rat. A switching power supply provides a power supply of 5V for a refrigeration piece, a temperature control resistor can sense the temperature of hot water to further control the working status of the refrigeration piece and consequently control the water temperature, and a water collection barrel collects the water which is carelessly dropped by the drinking rat. The observation of the reduced water amount in the water bottle and the water collection amount in the water collection barrel can obtain the water intake amount of the rat, thereby judging the cold hot drink preference of the rat.
Owner:SHANDONG UNIV OF TRADITIONAL CHINESE MEDICINE

Straw combustion fire point identification method based on heat source heavy industry region analysis

The invention discloses a straw combustion fire point identification method based on heat source heavy industry region analysis. The method comprises the following steps: obtaining fire point originaldata, ruby heat source heavy industry region product data and ground surface coverage product data of a target research region; preprocessing the data respectively; constructing a heat source heavy industry buffer area space according to the preprocessed product data of the ruby heat source heavy industry area so as to identify a fire point type in the heat source heavy industry buffer area space; and identifying the straw combustion fire point according to the fire point type in the heat source heavy industry buffer area space in combination with the preprocessed surface coverage product data. The method has the following advantages: the characteristics of high time resolution, wide coverage range and heat source heavy industry area distribution and operation production of long-time-sequence active fire point data are utilized, the ground surface coverage product and the heat source heavy industry area are combined, the accuracy of straw combustion identification is improved, and misjudgment of high-frequency fire points of the heat source heavy industry on straw combustion fire points is avoided.
Owner:三亚中科遥感研究所

Method for testing BNP (Brain Natriuretic Peptide) activity by using GCA stable transfection cell line

The invention discloses a method for testing BNP (Brain Natriuretic Peptide) activity by using a GCA stable transfection cell line and establishes a novel BNP bioactivity testing method. GCA which is a main acceptor of BNP is an adenylate cyclase precursor and can catalyze GTP (guanosine triphosphate) to generate cGMP after being activated by the BNP and then exerts a biological effect. Wield 293 cell has low GCA expression level and low reactivity to BNP. In the method disclosed by the invention, a stable cell line 293GCAC3 with BNP acceptor (GCA) overexpression level is structured by transgenosis, the content change of cGMP secreted into cell supernatant by the 293GCAC3 stimulated by the BNP is detected to quantify the activity of the BNP. The method comprises the following specific testing steps of: laying cells on a 96-pore plate and culturing for 16-18 hours; adding the BNP for stimulating for 90 minutes; and sucking cell supernatant and detecting the content of cGMP with competitive ELISA (enzyme-linked immuno sorbent assay). The method is simple to operate, has sensitive response and small variability and is significant for the quality control and clinical application of the BNP.
Owner:NAT INST FOR FOOD & DRUG CONTROL

Glasses wearing comfort evaluation method based on eye movement technology

The invention relates to a glasses wearing comfort evaluation method based on an eye movement technology. The method comprises the following steps: acquiring eye movement data and eye pictures of a subject within a period of time, processing the acquired eye images to calculate eyelid spacing abnormal time percentage and blinking frequency, and establishing a multiple linear regression model according to the eyelid spacing abnormal time percentage and the blinking frequency to judge the comfort degree of the glasses. According to the invention, through a large amount of subjective sampling andexperiments, the influence of eyelid spacing and blinking frequency on the wearing comfort of glasses is quantitatively studied. A sample database and a multivariate linear regression model are established, a comfort judgment score interval is obtained. A quantitative standard is provided for subsequent glasses wearing comfort judgment, and then a multivariate linear regression model can be obtained according to the multivariate linear regression model.
Owner:JIANGSU MINGYUE PHOTOELECTRICS TECH

Candida tropicalis PCR (polymerase chain reaction) assay kit and method

The invention relates to the field of microorganism assay, and in particular relates to a candida tropicalis PCR (polymerase chain reaction) assay kit. The kit comprises a PCR solution, wherein the PCR solution comprises primers and a fluorescent probe A; the primers are divided into a forward primer A and a reverse primer A; the nucleotide sequence of the forward primer A is shown in the SEQ ID NO.1; the nucleotide sequence of the reverse primer A is shown in the SEQ ID NO.2; and the nucleotide sequence of the fluorescent probe A is shown in the SEQ ID NO.3. The kit has the advantages of high sensitivity and specificity, stability, timeliness, convenience in operation and the like.
Owner:泰普生物科学(中国)有限公司

Method for evaluating aging degree of silicone rubber through inorganic degree

The invention discloses a method for evaluating the aging degree of silicone rubber through the inorganic degree, wherein the method comprises the following steps: 1, selecting a silicone rubber product to be tested as a test sample, and selecting inorganic SiO2 as a control sample; 2, carrying out infrared spectrum characterization on the test surface of the test sample and the surface of the control sample by using an infrared spectrometer to obtain an infrared characteristic spectrogram of Si-O-Si of the test sample and an infrared characteristic spectrogram of inorganic SiO2; and step 3, judging the inorganic degree of the silicone rubber product according to the displacement difference of the infrared characteristic peak of Si-O-Si relative to the infrared characteristic peak of inorganic SiO2 on the wave number, and further evaluating the aging degree of the silicone rubber product through the inorganic degree. According to the method, the surface inorganic degree of the silicone rubber product is represented by the infrared spectrometer, the aging degree of the silicone rubber product is evaluated through the inorganic degree, the operation is simple, the result can be obtained through simple subtraction formula calculation, and the result is objective and reliable.
Owner:JIANGSU SHENMA ELECTRIC CO LTD

BMP-2 antibody and application to detection of content of BMP-2 protein in bone repairing material thereof

The invention discloses a BMP-2 antibody and application to detection of content of BMP-2 protein in a bone repairing material thereof. In the application, the BMP-2 antibody is an antibody secreted by an rhBMP-2 monoclonal antibody cell strain 44F5 which is preserved in China General Microbiological Culture Collection Center; the preservation number of the rhBMP-2 monoclonal antibody cell strain is CGMCC No.12257. Experiments show that the BMP-2 antibody is high in specificity, high in sensitivity, high in accuracy and high in stability when the BMP-2 antibody is used for detecting the content of the BMP-2 protein in the bone repairing material; the recovery ratio (which is a ratio of a BMP-2 content detection value to a BMP-2 content actual value) is 106.4%; the degree of precision is 5.2%; a method established for detecting the content of the BMP-2 protein in the bone repairing material or the bone tissue is relatively stable, is high in accuracy and is suitable for detecting the content of the BMP-2 protein in the bone repairing material as a conventional method.
Owner:YANTAI ZHENGHAI BIO TECH

Glasses comfort evaluation method based on eye image

The invention relates to a glasses comfort evaluation method based on an eye image. The glasses comfort evaluation method comprises the following steps of obtaining the eye image of a subject within aperiod of time; processing the obtained eye image to obtain eye movement parameters, wherein the eye movement parameters include a pupil diameter XPD and an eyelid spacing XES; obtaining the comfortlevel of the subject, and marking the value of the comfort level as Y; and according to a relation between the eyelid spacing and the comfort level and a relation between the pupil diameter and the comfort level, building function models between the comfort level and the pupil diameter and between the comfort level and the eyelid spacing, and then judging the comfort level of glasses. According tothe method, the influence of the eyelid spacing and the pupil diameter on the glasses wearing comfort is quantitatively studied through a large number of subjective sampling and experiments, and thefunction models about the comfort level, the pupil diameter and the eyelid spacing are built, so that a quantitative standard is provided for subsequent glasses wearing comfort judgment, whether the glasses of the subject are comfortable to wear or not can be directly and quickly judged, and a result is objective and reliable.
Owner:JIANGSU MINGYUE PHOTOELECTRICS TECH

Identification Method of Low Temperature Resistance of Wild Cotton at Seedling Stage

The invention belongs to plant physiology and particularly relates to a method for identifying low-temperature resistance of wild cotton in a seedling stage. The method comprises the following steps: 1) sulfuric acid delinting and incision treatment on seeds; 2) germination accelerating treatment; 3) seedling culture: common seedlings in a 3-5-leaf stage with consistent growth vigor are selected; 4) low-temperature stress treatment: low-temperature stress treatment closer to natural conditions is selected; 5) low-temperature resistance level classification: grading is performed according to damaged conditions of cotton seedlings, and resistance levels of the wild cotton are classified. According to the method, severe low-temperature stress treatment is performed in the seedling stage when the wild cotton is most sensitive to low temperature, so that a low-temperature-resistant cotton material truly with higher resistance level can be screened out; grading is performed according to damaged conditions of cotton leaves, objective classification is performed, and errors caused by human factors are reduced greatly. The method is not limited by seasons, can be used for identifying mass materials and is easy to popularize and use.
Owner:INST OF COTTON RES CHINESE ACAD OF AGRI SCI

Application of GCA stable transfection cell line to test BNP (Brain Natriuretic Peptide) activity

The invention discloses a method for testing BNP (Brain Natriuretic Peptide) activity by using a GCA stable transfection cell line and establishes a novel BNP bioactivity testing method. GCA which is a main acceptor of BNP is an adenylate cyclase precursor and can catalyze GTP (guanosine triphosphate) to generate cGMP after being activated by the BNP and then exerts a biological effect. Wield 293 cell has low GCA expression level and low reactivity to BNP. In the method disclosed by the invention, a stable cell line 293GCAC3 with BNP acceptor (GCA) overexpression level is structured by transgenosis, the content change of cGMP secreted into cell supernatant by the 293GCAC3 stimulated by the BNP is detected to quantify the activity of the BNP. The method comprises the following specific testing steps of: laying cells on a 96-pore plate and culturing for 16-18 hours; adding the BNP for stimulating for 90 minutes; and sucking cell supernatant and detecting the content of cGMP with competitive ELISA (enzyme-linked immuno sorbent assay). The method is simple to operate, has sensitive response and small variability and is significant for the quality control and clinical application of the BNP.
Owner:NAT INST FOR FOOD & DRUG CONTROL

High-reactivity cell strain for detecting biologic activity of recombinant human epidermal growth factors

The invention relates to a high-reactivity cell strain for detecting biologic activity of recombinant human epidermal growth factors. Original rhEGF is used for detecting a living cell NIH3T3, after some genes in cells are knocked out randomly, monoclones are selected, a cell strain NIH3T3-CRSPRV2(6) better in rhEGF reactivity is obtained, after an NIH3T3-CRISPRV2(6) cell strain is identified through bibasic sequencing and transcriptome thermography experiment, some knockout genes are Pcdhgb4 and H1fx, and gRNA is respectively ATAGTCTGTGTTTCACTACC and GCGCCCTCGCTAGGGCCCGA. Specific detection steps include that for NIH3T3-CRSPRV2(6), a 96-hole plate is paved by 6,000 / hole, hunger treatment is performed for 30min with PBS, analysis culture mediums containing series concentration of rhEGF areadded, action is performed for 48h, and cell activity is detected by an MTT method. According to the detection method disclosed by the invention, the operation time is shortened, the reaction is acute, the signal-noise ratio is high, serum interference is reduced, and the detection method has important significance in quality control and clinical application of rhEGF.
Owner:NAT INST FOR FOOD & DRUG CONTROL

Method for testing spray effect of sprayer by using Nomuraea rileyi spores

The invention relates to a method for testing the spray effect of a sprayer by using Nomuraea rileyi spores, and belongs to the technical field of performance test of agricultural production equipment. The method includes the following steps of: adding Tween80 to an aqueous suspension containing the Nomuraea rileyi spores, performing ultrasonic concussion, adding water, and uniformly mixing to obtain a test solution; adopting a tested sprayer to spray the test solution towards the front sides and back sides of leaves of plants of the same variety at different distances and angles, after the surfaces of the leaves of the plants are naturally dried, collecting the sprayed plant leaves, washing the plant leaves with purified water, performing microscopic examination and counting on washing liquid under a microscope, and calculating the number of the spores per unit area. The comparison method of the spray effect of different sprayers is that: under the same spray conditions, once the number of the attached spores becomes larger, better spray efficiency and uniformity can be achieved. The scheme of the invention has the positive effects that: the verification test of the three-dimensional spray effect is carried out in the actual production process, and the result is more objective and reliable.
Owner:YUNNAN TOBACCO CO LTD KUNMING BRANCH +1
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products