The invention relates to a high-reactivity 
cell strain for detecting biologic activity of recombinant human epidermal growth factors. Original rhEGF is used for detecting a 
living cell NIH3T3, after some genes in cells are knocked out randomly, monoclones are selected, a 
cell strain NIH3T3-CRSPRV2(6) better in rhEGF reactivity is obtained, after an NIH3T3-CRISPRV2(6) 
cell strain is identified through bibasic sequencing and 
transcriptome thermography experiment, some knockout genes are Pcdhgb4 and H1fx, and gRNA is respectively ATAGTCTGTGTTTCACTACC and GCGCCCTCGCTAGGGCCCGA. 
Specific detection steps include that for NIH3T3-CRSPRV2(6), a 96-hole plate is paved by 6,000 / hole, hunger treatment is performed for 30min with PBS, analysis 
culture mediums containing series concentration of rhEGF areadded, action is performed for 48h, and 
cell activity is detected by an 
MTT method. According to the detection method disclosed by the invention, the 
operation time is shortened, the reaction is acute, the 
signal-
noise ratio is high, serum interference is reduced, and the detection method has important significance in 
quality control and clinical application of rhEGF.