Primer group, kit and detection method based on digital PCR for Y chromosome microdeletion detection
A technology of Y chromosome and detection method, which is applied in the field of biological detection, can solve problems such as lack of related solutions, and achieve the effects of reducing workload, reducing pain, and good product development potential
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] A primer set for the detection of Y chromosome microdeletions was designed to detect gene deletions at the sY84 and sY86 sites of the AZFa subregion, the sY127 and sY134 sites of the AZFb subregion, and the sY254 and sY255 sites of the AZFc subregion, which specifically included The following primer combinations:
[0045] The primer pair used to detect the SY84 site, the sequence is:
[0046] Upstream primer AGAAGCGTCTGATAGCAGGT, downstream primer GCCTACTACCTGGAGGCTTC;
[0047] The primer pair used to detect the SY86 site, the sequence is:
[0048] Upstream primer GTGACACACAGACTATGCTTC, downstream primer ACACACAGAGTGACAACACT;
[0049] The primer pair used to detect the SY127 site, the sequence is:
[0050] Upstream primer GGCTCACAAACGACGAGAAA, downstream primer CTGCAGGCAGTAATAAGTGA;
[0051] The primer pair used to detect the SY134 site, the sequence is:
[0052] Upstream primer GTCTGCCTCACCATATCACG, downstream primer ACCACTGCCAAAACTGTCAA;
[0053] The primer pair...
Embodiment 2
[0059] A kit for detecting Y chromosome microdeletions was constructed, the kit including the primer set described in Example 1. In a further preferred embodiment, the kit further includes: PCR master mix, positive control, negative control and microdroplet generating oil.
[0060] Wherein, the PCR master mix includes dye, Taq enzyme, dNTP, MgCl 2 . More specifically, the dye is: EvaGreen dye 2x (20x EvaGreen dye diluted 10 times) 0, the Taq enzyme reaction concentration is 6U, the reaction concentration of dNTP is 0.8mM, MgCl 2 The final concentration was 5.6 mM.
[0061] Wherein, the positive control is: blood cell DNA obtained from the peripheral blood of healthy adult males, the concentration is: 10-80ng / ul, and the negative control is sterile deionized water (no DNA and RNA).
[0062] Droplet Generation Oil, QX200 Droplet Generation Oil for EvaGreen, was purchased from Bio-Rad, USA.
Embodiment 3
[0064] A digital PCR-based detection method for detecting Y chromosome microdeletions is provided. The method utilizes the kit obtained in Example 2 to detect Y chromosome microdeletions by means of digital PCR. It specifically includes the following steps:
[0065] 1) Collect peripheral blood or fingertip blood of the patient to be tested, volume range: 50 μl-500 μl, DNA extraction can be performed using a general nucleic acid column extraction kit (Shanghai Sangong, B518253-0050), and the obtained DNA is subjected to ultraviolet ( 260nm) absorption detection to obtain the concentration and purity, and obtain the DNA sample to be tested, the concentration of which is ≥0.0001ng / ul;
[0066] 2) Evenly mix the obtained DNA sample with the PCR master mix, primer set, and sterile water. The volumes are 10ul of the PCR master mix, 0.4ul of the primer set (10uM), 2ul of the DNA extraction solution, and 7.2ul of the sterile water. Vortex and keep at 4°C for use;
[0067] 3) The mix...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com