Upland cotton phosphatidylinositol specific phospholipase C gene GhPIPLC2-2 and application thereof

A technology of cotton phosphatidylinositol and phospholipase, applied in the field of plant genetic engineering, to achieve the effect of improving plant salt tolerance and salt resistance

Active Publication Date: 2020-02-18
SHANDONG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the search found that the phosphatidylinositol-specific phospholipase C gene GhPIPLC2-2 of upland cotton and its application in improving plant salt tolerance have not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Upland cotton phosphatidylinositol specific phospholipase C gene GhPIPLC2-2 and application thereof
  • Upland cotton phosphatidylinositol specific phospholipase C gene GhPIPLC2-2 and application thereof
  • Upland cotton phosphatidylinositol specific phospholipase C gene GhPIPLC2-2 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1: high-fidelity PCR amplification GhPIPLC2-2 target gene

[0037] Take the young leaves and roots of 9807 four-leaf stage in upland cotton, refer to the instructions of the plant total RNA extraction kit (TIANGEN, Beijing, RN38), extract the total plant RNA, and use the PrimeScript RT Reagent Kit (TaKaRa, Dalian, RR047A) to invert The cDNA was obtained by reverse transcription with the recording kit. High-fidelity PCR amplification with specific primers.

[0038] The specific primer sequences are as follows:

[0039] GhPIPLC2-2-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTA ATGTCCAAACAAACTTACAGGG;

[0040] GhPIPLC2-2-R: GGGGACCACTTTGTACAAGAAAGCTGGGTT GATGAATTCAAAGTGCATAAGGAGC.

[0041] Underlines indicate BP-reactive homologous recombination sites.

[0042] The total volume of the PCR reaction is 50 μL, and the reaction system is: 10 μL 5×pfu Buffer, 1 μL dNTP, 1 μL forward primer, 1 μL reverse primer, 1 μL FastPfuDNA Polymerase, 1 μL cDNA template diluted ten t...

Embodiment 2

[0046] Example 2: Analysis of the expression pattern of the GhPIPLC2 gene under salt stress

[0047] The 9807 (Gossypium hirsutum L.Var. Zhong9807) seeds of upland cotton were sterilized and planted in the greenhouse under the following growth conditions: 30°C / 25°C, 60-70% relative humidity, 14 hours of light and 10 hours of darkness, and the photon flux density was 800 μmol m -2 the s -1 . When growing to the four-leaf stage, carry out salt (200mM NaCl) treatment, and the treatment time is 3h and 6h respectively. Total RNA was extracted and reversed into cDNA, diluted 10 times for real-time fluorescent quantitative PCR analysis. Upland cotton Histone gene (GenBankaccession number NC_006639) was used as the internal standard. Fluorescence quantitative PCR reaction kit is TAKARA's SYBR PremixEx TaqⅡ kit, the reaction is in 96System Fluorescence Quantitative Instrument, carried out 3 biological repetitions, the experimental results were measured by relative quantification ...

Embodiment 3

[0053] Embodiment 3: Verification of GhPIPLC2-2 gene function

[0054] 1. Construction of Arabidopsis expression vector

[0055] Take the young leaves and roots of 9807 four-leaf stage in upland cotton, refer to the instructions of the total plant RNA extraction kit (TIANGEN, Beijing, DP432), extract the total plant RNA, and use PrimeScript RT Reagent Kit (TIANGEN, Beijing, RN38) to invert The cDNA was obtained by reverse transcription with the recording kit. High-fidelity PCR amplification with specific primers. The specific primer sequences are as follows:

[0056] GhPIPLC2-2-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTA ATGTCCAAACAAACTTACAGGG;

[0057] GhPIPLC2-2-R: GGGGACCACTTTGTACAAGAAAGCTGGGTT GATGAATTCAAAGTGCATAAGGAGC (the underline indicates the BP homologous recombination site)

[0058] The total volume of the PCR reaction is 50 μL, and the reaction system is: 10 μL 5×pfu Buffer, 1 μL dNTP, 1 μL forward primer, 1 μL reverse primer, 1 μL FastPfuDNA Polymerase, 1 μL cDNA t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an upland cotton phosphatidylinositol specific phospholipase C gene GhPIPLC2-2. The nucleotide sequence of cDNA (complementary deoxyribonucleic acid) of the gene is shown in SEQ ID No.1 in the description, and an amino acid sequence encoded by the gene is shown in SEQ ID No.2 in the description. The invention further discloses application of the gene GhPIPLC2-2 in culturingsalt-resistant plants or improving salt resistance of plants. Experiments show that arabidopsis with overexpression of the GhPIPLC2-2 gene is sensitive to salt, the salt resistance of a plant can beremarkably improved through gene knockoff or RNAi (ribonucleic acid interfere), and it indicates that the GhPIPLC2-2 gene has significant functions in application in culturing salt resistant plants.

Description

technical field [0001] The invention relates to the phosphatidylinositol-specific phospholipase C gene GhPIPLC2-2 of upland cotton and its application in improving the salt tolerance of plants. It belongs to the field of plant genetic engineering. Background technique [0002] Population growth and changes in the agro-ecological environment affect people's food security. High salinity stress will lead to crop yield reduction. In order to reduce the impact of high-salt stress on food production safety, people need to breed new crop varieties adapted to the "high-salt environment" in the hope that these varieties can withstand high-salt stress and have good growth and development, and achieve high yield and high yield in saline-alkali land. To meet people's growing demand for agricultural products. Therefore, it is of great significance to cultivate salt-tolerant plants. [0003] Phospholipids are an important component of biological membranes, and some members of phosphol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/55C12N9/16C12N15/82A01H5/00A01H6/20A01H6/60
CPCC12N9/16C12Y301/04003C12N15/8273
Inventor王红蕾张可炜白明义
OwnerSHANDONG UNIV