Bifidobacterium lactis bl-99 with function of enhancing immunity and application thereof
A technology for Bifidobacterium lactis and bacterial preparation, which is applied in the field of microorganisms to achieve the effects of improving low immunity, enhancing humoral immunity and wide application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Embodiment 1: Bifidobacterium lactis BL-99 and performance measurement thereof
[0041] The Bifidobacterium lactis BL-99 of the present invention is from Shanghai Jiaoda Only Co., Ltd., and is isolated from the intestinal tract of infants. The strain was preserved in China General Microorganism Culture Collection and Management Center CGMCC on April 26, 2018 (Address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), taxonomic name: Bifidus lactis Bacillus (Bifidobacterium lactis); the deposit number is CGMCC No.15650.
[0042] 1. Taxonomic characteristics of Bifidobacterium lactis BL-99
[0043] Physical and chemical test results:
[0044]
[0045] 16S rRNA gene sequence sequencing results (SEQ ID No.1):
[0046] GCTCCCCCACAAGGGTCGGGCCACCGGCTTCGGGTGCTACCCACTTTCATGACTTGACGGGCGGTGTGTACAAGGCCCGGGAACGCATTCACCGCGGCGTTGCTGATCCGCGATTACTAGCGACTCCGCCTTCACGCAGTCGAGTTGCAGACTGCGATCCGAACTGAGACCGGTTTTCAGC...
Embodiment 2
[0060] Example 2: Analysis of Immunomodulatory Activity
[0061] After culturing Bifidobacterium lactis BL-99 in MRS liquid medium at 37°C for 16 hours, centrifuge at 4°C and 2500rpm for 10 minutes to collect the bacteria, wash with phosphate buffered saline (PBS) and freeze-dry at -18°C Save below. Used in various experimental studies of this example.
[0062] 700 healthy male BALB / C mice, 6-8 weeks old, 16-18g, were provided by Beijing Weitong Lihua Experimental Animal Technology Co., Ltd. Raised in the Animal Laboratory of the Occupational Health and Poison Control Institute of the Chinese Center for Disease Control and Prevention: maintain room temperature (25±2°C), relative humidity (55±2)%, 12h / 12h light, free access to food and water.
[0063] The animals were randomly divided into 5 large groups, which were used in various experimental researches of this embodiment, with 140 mice in each large group, 1 normal control group was set up in each large group, and 1 normal...
Embodiment 3
[0121] Embodiment 3: the preparation of BL-99 bacterial powder and its use in the production of food
[0122] refer to figure 1 In the shown fermentation process, the Bifidobacterium lactis BL-99 provided by the present invention (that is, the Bifidobacterium lactis with a preservation number of CGMCC No. 15650) is anaerobically cultured in TPY liquid medium. TPY liquid medium (g / L): hydrolyzed casein 10.0, soybean peptone 5.0, yeast powder 2.0, glucose 5.0, L-cysteine 0.5, dipotassium hydrogen phosphate 2.0, magnesium chloride 0.5, zinc sulfate 0.25, calcium chloride 0.15, ferric chloride 0.0001, Tween 80 1.0, pH 6.5±0.1. Centrifuge the fermentation broth after primary, secondary and expanded cultivation at 4°C and 2500rpm for 10 minutes, collect the bacteria, freeze-dry to obtain BL-99 bacterial powder, and store it below -18°C.
[0123] The BL-99 bacterial powder prepared in this example can be used for food, feed or medical purposes. The food can be, for example, comm...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap