Unlock instant, AI-driven research and patent intelligence for your innovation.

Bifidobacterium lactis bl-99 with function of enhancing immunity and application thereof

A technology for Bifidobacterium lactis and bacterial preparation, which is applied in the field of microorganisms to achieve the effects of improving low immunity, enhancing humoral immunity and wide application prospects

Active Publication Date: 2020-04-07
INNER MONGOLIA YILI INDUSTRIAL GROUP CO LTD
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] On the one hand, the present invention provides a kind of Bifidobacterium lactis (Bifidobacterium lactis), and this bacterial strain has the ability of significantly enhancing humoral immunity and activating NK cells, and can be used to improve the disease caused by irregular diet and increased work pressure. low immunity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bifidobacterium lactis bl-99 with function of enhancing immunity and application thereof
  • Bifidobacterium lactis bl-99 with function of enhancing immunity and application thereof
  • Bifidobacterium lactis bl-99 with function of enhancing immunity and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1: Bifidobacterium lactis BL-99 and performance measurement thereof

[0041] The Bifidobacterium lactis BL-99 of the present invention is from Shanghai Jiaoda Only Co., Ltd., and is isolated from the intestinal tract of infants. The strain was preserved in China General Microorganism Culture Collection and Management Center CGMCC on April 26, 2018 (Address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), taxonomic name: Bifidus lactis Bacillus (Bifidobacterium lactis); the deposit number is CGMCC No.15650.

[0042] 1. Taxonomic characteristics of Bifidobacterium lactis BL-99

[0043] Physical and chemical test results:

[0044]

[0045] 16S rRNA gene sequence sequencing results (SEQ ID No.1):

[0046] GCTCCCCCACAAGGGTCGGGCCACCGGCTTCGGGTGCTACCCACTTTCATGACTTGACGGGCGGTGTGTACAAGGCCCGGGAACGCATTCACCGCGGCGTTGCTGATCCGCGATTACTAGCGACTCCGCCTTCACGCAGTCGAGTTGCAGACTGCGATCCGAACTGAGACCGGTTTTCAGC...

Embodiment 2

[0060] Example 2: Analysis of Immunomodulatory Activity

[0061] After culturing Bifidobacterium lactis BL-99 in MRS liquid medium at 37°C for 16 hours, centrifuge at 4°C and 2500rpm for 10 minutes to collect the bacteria, wash with phosphate buffered saline (PBS) and freeze-dry at -18°C Save below. Used in various experimental studies of this example.

[0062] 700 healthy male BALB / C mice, 6-8 weeks old, 16-18g, were provided by Beijing Weitong Lihua Experimental Animal Technology Co., Ltd. Raised in the Animal Laboratory of the Occupational Health and Poison Control Institute of the Chinese Center for Disease Control and Prevention: maintain room temperature (25±2°C), relative humidity (55±2)%, 12h / 12h light, free access to food and water.

[0063] The animals were randomly divided into 5 large groups, which were used in various experimental researches of this embodiment, with 140 mice in each large group, 1 normal control group was set up in each large group, and 1 normal...

Embodiment 3

[0121] Embodiment 3: the preparation of BL-99 bacterial powder and its use in the production of food

[0122] refer to figure 1 In the shown fermentation process, the Bifidobacterium lactis BL-99 provided by the present invention (that is, the Bifidobacterium lactis with a preservation number of CGMCC No. 15650) is anaerobically cultured in TPY liquid medium. TPY liquid medium (g / L): hydrolyzed casein 10.0, soybean peptone 5.0, yeast powder 2.0, glucose 5.0, L-cysteine ​​0.5, dipotassium hydrogen phosphate 2.0, magnesium chloride 0.5, zinc sulfate 0.25, calcium chloride 0.15, ferric chloride 0.0001, Tween 80 1.0, pH 6.5±0.1. Centrifuge the fermentation broth after primary, secondary and expanded cultivation at 4°C and 2500rpm for 10 minutes, collect the bacteria, freeze-dry to obtain BL-99 bacterial powder, and store it below -18°C.

[0123] The BL-99 bacterial powder prepared in this example can be used for food, feed or medical purposes. The food can be, for example, comm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides bifidobacterium lactis BL-99 with a function of enhancing the immunity and application thereof and belongs to the technical field of microbes. The bifidobacterium lactis BL-99 is preserved in the China General Microbiological Culture Collection Center CGMCC on April 26, 2018, has a preservation number of CGMCC No.15650, has high gastric acid tolerance and intestinal juice tolerance, can remarkably increase antibody-producing cells and half value of hemolysin HC50 and activate the activity of NK cells, can be used for preparing foods and the like with a function of enhancing the immunity, and has an extensive application prospect.

Description

technical field [0001] The invention relates to the technical field of microbes, in particular to a strain of Bifidobacterium lactis with immune regulation activity. Background technique [0002] Immunity is a physiological function of the human body, which involves non-specific immunity and specific immunity. Non-specific immunity does not require prior contact with antigens. Once pathogens enter the body, they will quickly eliminate pathogens. Both phagocytes and natural killer cells have clearance and killing functions, and are important members of the non-specific immune system. Specific immunity has immune cells (T lymphocytes and B lymphocytes) that specifically recognize foreign substances and have immune memory capabilities. The most important information transducers between the immune system are cytokines, each of which has different stimulating functions on different cell types, and they induce the growth and functional activity of cells by binding to specific rec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A23L33/135A23K10/18A61K35/745A61P37/04C12R1/01
CPCC12N1/20A23L33/135A23K10/18A61P37/04A61K2035/115A23V2002/00C12R2001/01C12N1/205A23V2400/531A23V2200/324Y02A50/30
Inventor 洪维鍊刘伟贤赵雯孙婷司徒文佑
Owner INNER MONGOLIA YILI INDUSTRIAL GROUP CO LTD