Use of mir-93 inhibitors in the preparation of medicines for repairing dentin

An inhibitor and dentin technology, applied in the field of dentin regeneration drugs, can solve rare problems, and achieve the effect of making up for the lack of curative effect and having a good application prospect.

Inactive Publication Date: 2021-02-05
SICHUAN UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have found that miR-93 can regulate angiogenesis, immune cell function, and biological performance of cancer cells, but it is rarely reported in the formation and repair of dental hard tissues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of mir-93 inhibitors in the preparation of medicines for repairing dentin
  • Use of mir-93 inhibitors in the preparation of medicines for repairing dentin
  • Use of mir-93 inhibitors in the preparation of medicines for repairing dentin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 miR-93 expression down-regulation virus promotes dentin formation in vivo

[0031] 1. Method

[0032] 1.1 Plasmid construction and virus embedding

[0033] Use AAV Helper-Free System to produce recombinant AAV particles (i.e. miR-93 expression down-regulation virus), which can down-regulate miR-93 expression in dental pulp stem cells. It is a preferred miR-93 inhibitor of the present invention, and its process is as follows:

[0034] 1) Design the target fragment of rat-derived miR-93-5p (rno-miR-93-5p), that is, the reverse complementary sequence CTACCTGCACGAACAGCACTTTG (SEQ ID NO.1) of miR-93-5p. The above sequence was cloned into the viral vector GV479, which was the experimental group (AAV-miR-93-down group). The sequence inserted into the control group (AAV-Scramble group) was CGCTGAGTACTTCGAAATGTC (SEQ ID NO.2). The viral vector contains an inverted terminal repeat (ITR) sequence and a multiple cloning site (MCS) segment. The sequence of its elements...

Embodiment 2

[0050] Example 2 Culture and Identification of Human Dental Pulp Stem Cells

[0051] 1. Method

[0052] Clinically collected tooth samples aged 12-25 due to orthodontic needs or impacted teeth extraction, rinsed the isolated teeth repeatedly with sterile saline, placed them in PBS and collected pulp tissue samples within 2 hours. A dental split drill cuts around the neck of the tooth to expose the pulp cavity. The pulp tissue was removed with a sterilized pulp extraction needle, and the operation should be gentle to avoid tissue damage. The extracted dental pulp tissue was rinsed with sterile PBS solution, and placed in a pre-configured ordinary medium (DMEM medium containing 15% fetal bovine serum FBS and 1% double antibody). Use sterile ophthalmic scissors to cut up the pulp tissue as much as possible, transfer it to a 1.5mL EP tube, add 1mL Type I collagenase (3mg / mL), and incubate in an incubator for 1.5 hours, with vigorous shaking every 10 minutes during the period , ...

Embodiment 3

[0058] Example 3 Downregulation of miR-93 expression virus promotes the differentiation of dental pulp stem cells to form odontocytes and secrete dentine matrix

[0059] 1. Method

[0060] The P2 generation of human dental pulp stem cells obtained in Example 2 was inoculated in a six-well plate, and when the confluence reached 90% and the cells were in good condition, mineralization induction medium (OM) was added to induce odontogenic differentiation, 37 °C, 5% CO 2 The cells were cultured in an incubator under certain conditions, and the cells were replaced every other day. Cells in the undifferentiated stage (day 0, 0d), early stage of differentiation (day 7, 7d), and late stage of differentiation (day 14, 14d) were collected, and the total RNA containing microRNA in the cells was extracted using miRNeasy Kit (Qiagen Inc). cDNA was synthesized according to the operating procedures of the reverse transcription kit, and the expression patterns of miR-93 and target genes JMJ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a medicine for restoring dentin and belongs to the field of medicine for dentin regeneration. The inventors found through research that the inhibitor of miR-93 has the effect of promoting dentin regeneration. The principle is to increase the expression of histone demethylase JMJD3 by inhibiting miR-93, and regulate the differentiation of dental pulp cells into odontoblasts. and dentin formation. The invention can promote natural dentin regeneration, can be used as a pulp capping agent used in pulp capping, can overcome the problems of diffuse calcification of dental pulp caused by existing pulp capping agents, high technical requirements for operation, and cause tooth discoloration, etc. application prospects.

Description

technical field [0001] The invention belongs to the field of medicine for dentin regeneration, and in particular relates to the use of miR-93 inhibitors in the preparation of medicines for restoring dentin. Background technique [0002] Teeth are the hardest organs in the human body, which are divided into three parts: the crown, the neck and the root. Structural composition is divided into enamel (enamel), dentin (dentin), pulp (nerve gland) and so on. Enamel and dentin protect the pulp tissue from infection and pulpitis. [0003] Dentin defects can be caused by mechanical damage, caries, or diseases such as dentin hypoplasia. When the defect exposes the pulp tissue, in order to repair and preserve the pulp, pulpotomy is often used, that is, to remove the infected part of the pulp tissue, and place drugs on the pulp section to promote the formation of reparative dentin on the pulp section. ), retain the underlying vital pulp tissue, thereby retaining the normal tooth tis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): A61K45/00A61K48/00A61K31/7088A61P1/02
CPCA61K31/7088A61K45/00A61P1/02
Inventor 周雅川吴偲高诗祺周学东郑黎薇
Owner SICHUAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap