Salmonella efficient traceless gene editing system and application thereof
A Salmonella gene editing technology, applied in the field of genetic engineering, can solve the problem of lack of Salmonella gene editing system and achieve the effect of improving operation efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] A high-efficiency and scarless gene editing system for Salmonella of the present invention, the high-efficiency and scarless gene editing system for Salmonella includes Cas9 protein, sgRNA, λRed recombinase, DNA fragments of homologous recombination and the vectors used to carry or express these components and gene sequence.
[0048] The high-efficiency traceless gene editing system for Salmonella consists of a double-plasmid CRISPR / Cas9 system, including an auxiliary plasmid A expressing related functional proteins and a targeting plasmid B expressing a target site sgRNA.
[0049] The said helper plasmid A comprises the nucleic acid sequence of the following elements: Cas9 protein, λRed recombinase, thermosensitive replicon, sgRNA expression cassette targeting plasmid B replicon and helper plasmid A selection marker gene, wherein recombinase and sgRNA are induction Express.
[0050] The targeting plasmid B includes the nucleic acid sequence of the following elements: ...
Embodiment 3
[0117] Replacement of the Salmonella VNP20009msbB site with the RFP gene
[0118] The application flow chart of Salmonella high-efficiency traceless gene editing system is as follows: figure 2 shown. On the first day, the pCas plasmid is transferred to Salmonella, and the strain obtained in this step can be preserved for editing a series of target genes. The next day, when preparing pCas-Salmonella competent, add L-arabinose to induce the expression of λ-Red recombinase, and then transfer the pTAT-X plasmid, and spread the Kan+ / Amp+ plate. The homologous template and the target gene in the positive clone were double exchanged, and the wild-type clone was continuously cut double-stranded DNA by Cas9 mediated by X-N20sgRNA, making it difficult for the wild strain to grow. On the third day, a single clone was picked to identify the genome editing effect, and the successfully edited clone was added with IPTG to induce the expression of pMB1-N20sgRNA targeting the replicon of th...
Embodiment 4
[0132] Replacing the Salmonella VNP20009 eutC site with the RFP gene
[0133] The pTAT-eutC-RFP plasmid (SEQ ID NO: 3) was constructed. 636 bp in eutC-ORF (CP007804.2, 2,508,639~2,509,274) was replaced with RFP-ORF. Select 5'-ggcgctgttgcgcttcctgg-3' as eutC2-N20, and design primer pTA-eutC2-F (sequence is ggcgctgttgcgcttcctgggttttagagctagaaatagc) according to the selected N20 sequence to construct a targeting plasmid, thereby expressing the gene that can mediate Cas9 protein cleavage of the corresponding target site of msbB gene sgRNA. Primer pTA-eutC2-R / pTA-carrier-R amplification uses pTA plasmid as a template to PCR amplify the pTAT vector backbone; primer pTA-eutC2-F / pTA-carrier-F uses pTA plasmid as a template to amplify eutC2-sgRNA; primer eutC2-on-plasmid template-F / eutC2-on-RFP-R uses the Salmonella VNP20009 genome as a template to amplify the 301bp upstream homology arm of the eutC site; primers RFP-msbB-middle-F / RFP-msbB-middle-R to synthesize TagRFP The fragment ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


