Supercharge Your Innovation With Domain-Expert AI Agents!

Oilseed rape BnMAN7 gene and application thereof

A gene and rape technology, which is applied to the rape BnMAN7 gene and its application field to achieve the effects of high reliability, easy mechanized harvesting, and enhanced silique crack resistance

Active Publication Date: 2020-07-28
JIANGSU UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005]Currently, there are few researches on the resistance to silique cracking at home and abroad, and it is urgent to find the related genes involved in silique cracking in rapeseed. Controlling the genes related to silique dehiscence and studying their functions is the basis for cultivating mechanized harvesting varieties and the main goal of molecular breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oilseed rape BnMAN7 gene and application thereof
  • Oilseed rape BnMAN7 gene and application thereof
  • Oilseed rape BnMAN7 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1. BnMAN7 Gene acquisition

[0031] Arabidopsis hemicellulase gene MANNANASE7 (The nucleotide sequence is shown in SEQ ID NO.20, the GENEBANK database accession number is: BT008749.1, the amino acid sequence is shown in SEQ ID NO.21, the GENEBANK database accession number is: AAP49511.1), in the database For rape gene screening, it was finally confirmed that BnaA07g12590D (nucleotide sequence shown in SEQ ID NO.1) was used as the research object, and further cloned from Brassica napus Zhongshuang 11 (seeds were purchased from Wuhan Zhongyou Seed Industry Technology Co., Ltd.) This gene was studied and its function was studied, and the cloned gene was named BnMAN7 ,Specific steps are as follows:

[0032] (1) Plant material cultivation:

[0033] The Brassica napus Zhongshuang No. 11 plant (the seeds were purchased from Wuhan Zhongyou Seed Industry Technology Co., Ltd. and planted by our laboratory) was used as the experimental material, and the growth conditi...

Embodiment 2

[0051] Example 2. BnMAN7 Tissue-specific expression pattern analysis of genes

[0052] to explore genes BnMAN7 The differential expression in various tissues of Brassica napus was detected by q-PCR technology BnMAN7 Expression patterns in Brassica napus roots, stems, shoot tips, leaves, flowers, flower buds, young siliques (15 days after anthesis), mature siliques (50 days after anthesis). The plant material used in this example is Brassica napus Zhongshuang No. 11. Each tissue material was collected and immediately frozen with liquid nitrogen, and stored in a -70°C ultra-low temperature refrigerator for later use. According to the method in Example 1, RNA from various tissues of rapeseed was obtained and cDNA was synthesized.

[0053] exist BnMAN7 Real-time fluorescent quantitative PCR primers were designed for the non-conserved region of the gene sequence, and the primer sequences were:

[0054] qman7-F (SEQ ID NO.7): 5'-AGACTCGAACGAGCAATCCC-3'

[0055] qman7-R (SEQ ID...

Embodiment 3

[0058] Example 3. Inhibition BnMAN7 Obtaining Transgenic Rapeseed Plants with Gene Expression

[0059] (1) Inhibition BnMAN7 Expressed RNAi vector construction:

[0060] Constructed in embodiment 1 step (3) BnMAN7 -pMD19-T recombinant plasmid as template, amplified BnMAN7 The 158bp specific fragment on the gene is a non-conserved fragment of the gene. Interfering with this sequence will cause the gene to be silenced and lose its function. The specific nucleotide sequence of this fragment is shown in SEQ ID NO.9, specifically: :

[0061] ATGAAGCCCTCTGTGTCTGGTTACAATCCTATCGATCCTGATCCAACAAAGCTATTTGAAGCTCGGAGCAGATGCGTTTTCGAGAGATGGGTTCGTGAGAACGAAAGGTGTTCAGTTTAGCCTCAATGGCTATCCTTATTACGCTAATGGCTTCAATGC

[0062] The primer sequences used for amplification are:

[0063] Iman7-F (SEQ ID NO.10): 5'-CACCATGAAGCCCTCTGTGTCTGGTTA-3'

[0064] Iman7-R (SEQ ID NO.11): 5'-GCATTGAAGCCATTAGCGTA-3'

[0065] Primers were synthesized by Shanghai Shenggong Company.

[0066] Use the high-fidelit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
hydrophilicityaaaaaaaaaa
Login to View More

Abstract

The invention provides an oilseed rape BnMAN7 gene and application thereof, and belongs to the technical fields of plant genetic engineering and biology. The oilseed rape BnMAN7 gene is relevant withthe cracking character of silique, and a nucleotide sequence of the oilseed rape BnMAN7 gene is represented by SEQ ID NO.1. The oilseed rape silique crack-resistance relevant gene BnMAN7 is obtained through cloning, the crack resistance of the silique can be enhanced by inhibiting expression of the gene, and a novel breeding material is provided for further cultivation of novel oilseed rape species with the cracking resistance of the silique; and a BnMAN7 suppression expression strain is obtained by converting oilseed rapes through a further constructed pHellsgate12-BnMAN7 recombinant vector,so that a raw material is provided for researching the oilseed rape silique crack resistance through the BnMAN7 gene, theoretical direction is provided for crack-resistance breeding of the crop silique, and cultivation of high-yield novel species easy for mechanical harvesting is promoted.

Description

technical field [0001] The present invention relates to a kind of rapeseed BnMAN7 The gene and its application belong to the fields of plant genetic engineering and biotechnology. Background technique [0002] Brassica napus has a high seed yield and is mainly planted in the middle and lower reaches of the Yangtze River in my country. It is one of the most widely planted oil crops in my country, accounting for about 20% of the world's output. However, due to the low degree of mechanization of rapeseed production in my country and the high production cost, it cannot meet the domestic consumption demand, and there is still a large amount of oilseed consumption that depends on imports. Therefore, improving the production efficiency of rapeseed and increasing the yield of rapeseed is an important goal of rapeseed research in our country. [0003] The cracking of siliques will cause a large number of seeds to fall off before harvest, resulting in a large reduction in yield. At ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82C12N1/21A01H5/00A01H6/20C12R1/01
CPCC07K14/415C12N15/8266
Inventor 谭小力禹艳坤王伟杰王政朱克明李玉龙杨艳华丁丽娜曹军
Owner JIANGSU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More