T lymphocyte of chimeric chondroitin sulfate proteoglycan 4 receptor as well as preparation method and application of T lymphocyte
A chondroitin sulfate, proteoglycan technology, applied in the field of bioengineering, can solve the problem of insignificant tumor effect, and achieve the effect of significant technological progress
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1: Expression of CSPG4 in head and neck squamous cell carcinoma
[0044] Detection of CSPG4 mRNA in tumors: Take fresh or -80°C frozen tumor tissues and cut them into pieces, add 1ml TRIzon reagent to about 50mg of tissues, then homogenize on a homogenizer, and then use Converse Century CW0581S kit according to Instructions for extracting mRNA. After measuring the concentration of the extracted mRNA, use the Takara RR036A kit to perform reverse transcription into cDNA for storage according to the instructions. Then use the real-time fluorescent quantitative kit (Takara RR420A) to detect the expression level of CSPG4 in the cDNA according to the instructions, and the CSPG4 primers used:
[0045] Former: ctggagaatggtggaagag (SEQ ID NO.1)
[0046] Reverse: ggacagtgacagtgaagg (SEQ ID NO. 2)
[0047] GAPDH primers:
[0048] Former: caaggtcatccatgacaactttg (SEQ ID NO.3)
[0049] Reverse: gtccaccaccctgttgctgtag (SEQ ID NO. 4).
[0050] Staining of tumor tissue se...
Embodiment 2
[0053] Example 2: Transcription and expression of CSPG4 in human head and neck squamous cell carcinoma cell lines
[0054] Detection of CSPG4 mRNA in the cell line: Wash the detection cells with PBS and collect the precipitate, add 1ml TRIzon per 1,000,000 cells to lyse, and the subsequent detection method is the same as the tumor mRNA detection method in Example 1.
[0055] Western blot detection of CSPG4 protein expression in cell lines: collect cells, extract total protein with a protein extraction kit (Beiyuntian, P0013) according to the instructions, determine protein concentration by BCA method, add loading buffer to prepare electrophoresis samples, polyacrylamide Gel electrophoresis, after transfer, blocking, primary antibody and secondary antibody incubation, drop ECL developing reagent and develop and analyze on the gel image processing system. CSPG4 antibody used: Abcam ab139408.
[0056] Flow cytometry analysis of CSPG4 protein expression in cell lines: the detecti...
Embodiment 3
[0059] Example 3: CSPG4 has co-expression characteristics with tumor stem cell marker CD44 in head and neck squamous cell carcinoma
[0060] Cancer and Genome Tumor Atlas (TCGA) big data analysis: Download the gene transcript information of all head and neck squamous cell carcinoma specimens from the TCGA large database (website: https: / / cancergenome.nih.gov), and analyze the CSPG4 and CD44 gene transcripts by Pearson test level of correlation.
[0061] Co-staining of CSPG4 and CD44 in tumor tissue sections: The method for obtaining white slices of tumor tissue is the same as in Example 1. White slices were baked, dewaxed, hydrated, antigen retrieved, enzyme inactivated, blocked, incubated with primary and secondary antibodies, and counterstained with DAPI, then sealed, and finally observed and analyzed under a fluorescent microscope. Antibodies used: CSPG4 antibody: Atlas Antibodies HPA002951; CD44 antibody: Biolegend 103006.
[0062] Flow cytometry analysis of the co-express...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com