Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

T lymphocyte of chimeric chondroitin sulfate proteoglycan 4 receptor as well as preparation method and application of T lymphocyte

A chondroitin sulfate, proteoglycan technology, applied in the field of bioengineering, can solve the problem of insignificant tumor effect, and achieve the effect of significant technological progress

Active Publication Date: 2020-08-25
EYE & ENT HOSPITAL SHANGHAI MEDICAL SCHOOL FUDAN UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] Aiming at the above-mentioned technical problems in the prior art, the present invention provides a T lymphocyte (CSPG4.CAR-T) with chimeric chondroitin sulfate proteoglycan 4 receptor and its preparation method and application. Chondroitin Sulfate Proteoglycan 4 Receptor T Lymphocytes (CSPG4.CAR-T) and Its Preparation Method and Application To Solve the Insignificant Effect of CSPG4.CAR T Cells Designed for CSPG4 Targets in Treating Tumors in the Prior Art technical issues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • T lymphocyte of chimeric chondroitin sulfate proteoglycan 4 receptor as well as preparation method and application of T lymphocyte
  • T lymphocyte of chimeric chondroitin sulfate proteoglycan 4 receptor as well as preparation method and application of T lymphocyte
  • T lymphocyte of chimeric chondroitin sulfate proteoglycan 4 receptor as well as preparation method and application of T lymphocyte

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Expression of CSPG4 in head and neck squamous cell carcinoma

[0044] Detection of CSPG4 mRNA in tumors: Take fresh or -80°C frozen tumor tissues and cut them into pieces, add 1ml TRIzon reagent to about 50mg of tissues, then homogenize on a homogenizer, and then use Converse Century CW0581S kit according to Instructions for extracting mRNA. After measuring the concentration of the extracted mRNA, use the Takara RR036A kit to perform reverse transcription into cDNA for storage according to the instructions. Then use the real-time fluorescent quantitative kit (Takara RR420A) to detect the expression level of CSPG4 in the cDNA according to the instructions, and the CSPG4 primers used:

[0045] Former: ctggagaatggtggaagag (SEQ ID NO.1)

[0046] Reverse: ggacagtgacagtgaagg (SEQ ID NO. 2)

[0047] GAPDH primers:

[0048] Former: caaggtcatccatgacaactttg (SEQ ID NO.3)

[0049] Reverse: gtccaccaccctgttgctgtag (SEQ ID NO. 4).

[0050] Staining of tumor tissue se...

Embodiment 2

[0053] Example 2: Transcription and expression of CSPG4 in human head and neck squamous cell carcinoma cell lines

[0054] Detection of CSPG4 mRNA in the cell line: Wash the detection cells with PBS and collect the precipitate, add 1ml TRIzon per 1,000,000 cells to lyse, and the subsequent detection method is the same as the tumor mRNA detection method in Example 1.

[0055] Western blot detection of CSPG4 protein expression in cell lines: collect cells, extract total protein with a protein extraction kit (Beiyuntian, P0013) according to the instructions, determine protein concentration by BCA method, add loading buffer to prepare electrophoresis samples, polyacrylamide Gel electrophoresis, after transfer, blocking, primary antibody and secondary antibody incubation, drop ECL developing reagent and develop and analyze on the gel image processing system. CSPG4 antibody used: Abcam ab139408.

[0056] Flow cytometry analysis of CSPG4 protein expression in cell lines: the detecti...

Embodiment 3

[0059] Example 3: CSPG4 has co-expression characteristics with tumor stem cell marker CD44 in head and neck squamous cell carcinoma

[0060] Cancer and Genome Tumor Atlas (TCGA) big data analysis: Download the gene transcript information of all head and neck squamous cell carcinoma specimens from the TCGA large database (website: https: / / cancergenome.nih.gov), and analyze the CSPG4 and CD44 gene transcripts by Pearson test level of correlation.

[0061] Co-staining of CSPG4 and CD44 in tumor tissue sections: The method for obtaining white slices of tumor tissue is the same as in Example 1. White slices were baked, dewaxed, hydrated, antigen retrieved, enzyme inactivated, blocked, incubated with primary and secondary antibodies, and counterstained with DAPI, then sealed, and finally observed and analyzed under a fluorescent microscope. Antibodies used: CSPG4 antibody: Atlas Antibodies HPA002951; CD44 antibody: Biolegend 103006.

[0062] Flow cytometry analysis of the co-express...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a T lymphocyte of a chimeric chondroitin sulfate proteoglycan 4 receptor. The T lymphocyte comprises an extracellular domain structure, a human CD28 transmembrane sequence and an intracellular domain structure, wherein the extracellular domain structure is formed by sequentially connecting a signal peptide sequence, an optimized CSPG4 single-chain antibody sequence and a sequence with a human immunoglobulin G2 mutation sequence as a hinge region in series; a genetic sequence of the optimized CSPG4 single-chain antibody is as shown in any one of SEQ ID NO.33-42; a geneticsequence of the hinge region is as shown in SEQ ID NO.31; and the intracellular domain structure is formed by connecting a human CD28 or 41BB intracellular domain costimulatory domain sequence and ahuman CD3[zeta] intracellular domain sequence in series. The invention also provides a preparation method of the T lymphocyte of the chimeric chondroitin sulfate proteoglycan 4 receptor. Meanwhile, the invention provides an application of the T lymphocyte in preparation of drugs for treatment of head and neck tumors. The optimized CSPG4.CAR-T cell can be used for effectively killing the CSPG4 positive tumor cells in vitro and vivo.

Description

technical field [0001] The invention belongs to the field of bioengineering, and relates to a drug for treating tumors, specifically a T lymphocyte (CSPG4.CAR-T) with a chimeric chondroitin sulfate proteoglycan 4 receptor and its preparation method and application . Background technique [0002] Head and neck cancer refers to malignant tumors of epithelial origin that originate in the upper aerodigestive tract, including the nasal cavity, paranasal sinuses, oral cavity, pharynx (including nasopharynx, oropharynx, hypopharynx) and larynx. Head and neck cancer is one of the common malignant tumors in human beings. Its incidence ranks sixth among all malignant tumors. It occurs more frequently in men and is related to age. It is more likely to occur in people over 60 years old. The latest tumor statistics in the United States found that there were about 68,000 new cases of head and neck cancer in the past year, of which 70.4% were men. In China, there are about 130,000 new ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/62C12N15/867C12N7/01A61K39/00A61P35/00
CPCC07K14/7051C07K16/18C12N15/86C12N7/00C12N5/0636A61K39/0011A61P35/00C07K2319/02C07K2319/03C07K2319/33C12N2740/15021C12N2740/15043C12N2510/00A61K2039/80
Inventor 陈健吴海涛邱士真周霆陈敏方一
Owner EYE & ENT HOSPITAL SHANGHAI MEDICAL SCHOOL FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com