Polymorphic site associated with altitude hypoxia tolerance adaptability and application thereof
A polymorphic site, high altitude hypoxia technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc. The effect of broad application prospects and potential
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1 Study on Myocardial Hypoxia Tolerance of ALDH2 Knockout Mice
[0034] 1) Construct the intermittent hypoxia model in mice: Oxygen concentration: 5% (40s)-21% (40s); cycle time: 2min; daily intervention time (10h): 8:00-18:00, a total of 4 week intervention.
[0035] 2) Detection of the overall function of the mouse heart: small animal heart B-ultrasound detection of the wall thickness and systolic and diastolic functions of the mouse heart in each group.
[0036] 3) The size and shape of cardiomyocytes: the hearts of each group were taken, weighed, fixed, sliced, stained with HE, and the cross-sectional area of cardiomyocytes under a light microscope; frozen sections of myocardial tissue were prepared, and cell apoptosis was observed by TUNEL staining; Masson staining was used to evaluate the degree of myocardial fibrosis; myocardial DHE fluorescent staining was performed to evaluate the level of ROS in the myocardium; myocardial tissue was stained with Oil...
Embodiment 2
[0050] Example 2 Observation on Adaptability of Cardiomyocyte Hypoxia Tolerance in ALDH2 Point Mutation Knockout Mice
[0051] (1) Research methods:
[0052] The cardiomyocytes of each group of mice were isolated and cultured, and after hypoxia treatment at different time points in vitro, the level of mitophagy in individual cardiomyocytes of mice in each group was detected by immunofluorescence detection, and the key molecules of cardiomyocyte hypoxic metabolism were detected by Western blot ( Such as GLUT-1 and HIF-1α) expression level changes.
[0053] (2) Research results:
[0054] Such as image 3 As shown in A, after hypoxia treatment, the survival rate of cardiomyocytes in the KO group was significantly lower than that in the WT group, and the cell survival rate was less than 50% after 24 hours of hypoxia, which was consistent with the results of animal experiments, suggesting that Cardiomyocyte hypoxia tolerance decreased significantly. Immunofluorescence detection...
Embodiment 3
[0055] Example 3 Human ALDH2rs671 Site Mutation Detection
[0056] (1) Research methods:
[0057] Primer design and dilution,
[0058] Primer information: RS671-F: GGGTCAACTGCTATGATGTGT;
[0059] RS671-R: TTAGTAGGAAACACTGATGGC.
[0060] 1) PCR amplification
[0061] system:
[0062] Element system Premix Taq 10ul Primer1 1ul Primer2 1ul template 1ul wxya 2 o
7ul total 20ul
[0063] Reaction program: 94°C for 5min; 28cycles: 94°C for 30s, 58°C for 30s, 72°C for 1min; 72°C for 10min.
[0064] 2) Purification of PCR products by rubber tapping
[0065] The PCR product was subjected to 2% agarose gel electrophoresis, and the target bands of equal size were cut out, and purified and recovered according to the Tiangen recovery kit (DP214-03).
[0066] 3) Sanger sequencing experiment.
[0067] Sequencing reaction system: total system 5 μl, sequencing primer 2 μl (3.2 μM), purified PCR product 1-3 μl, BigDyeMix kit 1 μl. ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com