Unlock instant, AI-driven research and patent intelligence for your innovation.
Human secretory FNDC5 protein as well as preparation method and application thereof
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A FNDC5-R, secreted technology, applied in the field of genetic engineering
Active Publication Date: 2020-10-23
THE SECOND HOSPITAL OF SHANDONG UNIV
View PDF4 Cites 2 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0004] FNDC5 is the precursor protein of irisin, and there are few studies on it at present. The new subtype of human-derived FNDC5 protein that does not contain a transmembrane domain and can be directly secreted and its application in various diseases have not yet been investigated. been reported
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0043] A human-derived secreted FNDC5 protein does not contain a transmembrane domain and can be directly secreted and released into the blood. The amino acid sequence of the human-derived secreted FNDC5 protein is SED ID NO: 1:
[0046] The preparation method of the human-derived secreted FNDC5 protein described in embodiment 1 comprises the following steps:
[0047]1. Design primers from different sites at the C-terminus of the FNDC5 gene, perform PCR, run electrophoresis, and detect FNDC5 subtypes that are different from the C-terminals of the three known FNDC5 isoforms reported in Pubmed (that is, new FNDC5 isoforms body), specifically:
[0048] The primers are:
[0049] Upstream primer FNDC5-F: TGAGGCCGAGAAGATGGCCTCTAA;
[0050] Downstream primer FNDC5-R: TAGTGACAATGGCTGCTCTCTGCC;
[0051] Extract RNA from Blox5 cells, reverse transcribe into cDNA, and use the above primers for PCR;
[0157] The second group: obese mice-normal saline group: as the positive control group, a high-fat diet was given to make obese mouse models, and after 12 weeks, normal saline was injected intraperitoneally for 2 weeks;
[0158] The third group: obese mice-secreted FNDC5 group: as the experimental group, high-fat diet was given to make obese mouse models, and secreted FDNC5 protein was injected intraperitoneally for 2 weeks after 12 weeks.
[0159] Administration method and administration concentration: The secreted FNDC5 ...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a human secretory FNDC5 protein as well as a preparation method and application thereof, and relates to the technical field of geneengineering. The human secretory FNDC5 protein does not contain a transmembrane structural domain and can be directly secreted and released into blood. The human secretory FNDC5 protein can be used for preparing medicines for treating atherosclerosis, medicines for promoting bone formation and medicines for treating aplastic anemia, and can be used for preparing endothelial cell proliferation medicines. After fasting injection is conductedon a high-fat fed obese mouse model, the human secretory FNDC5 protein can effectively reduce the weight of an obese mouse, which shows that the protein can obviously improve body fat metabolism of anobese patient and obviously reduce the levels of plasmacholesterol, free fatty acid and triglyceride, and shows that the protein can obviously improve lipid metabolism disorder of the obese patient.
Description
technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a human-derived secreted FNDC5 protein and its preparation method and application. Background technique [0002] Irisin (irisin) is a protein containing 112 amino acid residues discovered in 2012. It is the product of an unknown protease that cleaves type III fibronectin domain-containing protein 5 (FNDC5). Irisin is a part of FNDC5. cutting product. The three FNDC5 subtypes found so far all contain a transmembrane domain (exon5), which anchors the protein on the cell membrane. The sequence of irisin is highly conserved in mammals. Human, mouse and rabbit irisin The amino acid sequence is exactly the same; however, the C-terminal base sequence of the FNDC5 gene of human and mouse and rabbit (animal source) is different. If the animal-derived FNDC5 protein is directly injected into the human body, rejection may occur due to species issues. In addition to having all t...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More 
