High-yield pyocyanin engineering bacterium and construction method and application thereof

A pyocyanin and engineering bacteria technology, applied in the field of genetic engineering, can solve the problems of bacterial inability to carry out metabolic transport, cell death, accelerated bacterial oxygen consumption, etc.

Inactive Publication Date: 2020-10-30
SOUTH CHINA AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As a virulence factor, pyocyanin can interact with the respiratory chain of the cell membrane, resulting in the inability of bacteria to carry out metabolic transport, and will accelerate bacterial oxygen consumption and produce H 2 o 2 and divert the electron flow, eventually causing the cell to die

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-yield pyocyanin engineering bacterium and construction method and application thereof
  • High-yield pyocyanin engineering bacterium and construction method and application thereof
  • High-yield pyocyanin engineering bacterium and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Construction of PA-A1(ΔPa acpP::Ec acpP) Gene Knockout Mutant

[0042] According to the PA2966 gene and its upstream and downstream sequences, design primers (the underlined part is the restriction site):

[0043] P1 (SEQ ID NO.3):ATAATC AAGCTTT GCGCATGAAAGACGACGAG

[0044] P2 (SEQ ID NO.4):TAGTGCTCATACCTTGTTTTCACTCCTATGG

[0045] P3 (SEQ ID NO.5):AAAACAAGGTATGAGCACTATCGAAGAACG

[0046] P4 (SEQ ID NO. 6): TCTCGAATTCTTACGCCTGGTGGCCGTCGATG

[0047] P5 (SEQ ID NO.7):ACCAGGCGTAAGAATTCGAGACCGAAATCCC

[0048] P6 (SEQ ID NO.8): CGCCGA GGATCC AACCCATGGATACGCCGATAC

[0049] P7 (SEQ ID NO.9): TGGTCATCGGCACCGCGACCAGCGCGTC

[0050] P8 (SEQ ID NO. 10): CGGCCTCGCCATAGGCGATGTTGCGAGC

[0051] In order to obtain the PA-A1 (ΔPa acpP::Ec acpP) mutant strain, the present invention first constructed an acpP knockout vector. First, using the total DNA of Pseudomonas aeruginosa PAO1 as a template, amplify with P1 / P2, P3 / P4 primers respectively to obtain about 500 bp fragments of th...

Embodiment 2

[0055] Detection of Pyocyanin Content in PA2966 Gene Replacement Mutant Strain PA-A1

[0056] The extraction and detection of pyocyanin refer to the following methods:

[0057] 1. Inoculate Pseudomonas aeruginosa into a 15mL centrifuge tube with 5mL LB liquid medium, and culture overnight at 37°C with shaking.

[0058] 2. Transfer 5mL of the seed solution to 100mL of the pyocyanin production medium, the capacity of the Erlenmeyer flask is 250mL, and put it into a shaking incubator at 37°C, with a rotation speed of 200rpm.

[0059] 3. Take 5 mL of bacterial cells every 4 hours, centrifuge at 4000 rpm for 10 minutes, and collect the supernatant.

[0060] 4. Add 3 mL of chloroform, fully extract, and remove the lower organic phase.

[0061] 5. Add 1 mL of 0.2M HCl to the lower organic phase and shake vigorously for 1 min.

[0062] 6. Take 200 μL of the upper aqueous phase and detect the OD520nm value.

[0063] 7. Pyocyanin concentration (μg / mL) = OD520nm value × 17.072.

[0...

Embodiment 3

[0070] Determination of Pyocyanin Production of PA-A1 Mutant Strains in Different Production Mediums by Shaking Flask Fermentation

[0071] The growth of microorganisms and the production of metabolites are affected by many aspects such as nutritional conditions and culture conditions. In this study, by reviewing the literature, a variety of pyocyanin production media were collected, including GA medium, PDP medium, FD medium, and PPM medium, and wild-type PAO1 and PA-A1 mutant strains were cultivated to detect P. aeruginosa The concentration of pyocyanin was used to screen out the most suitable medium for the production of pyocyanin by the PA-A1 mutant strain. The result is as Figure 7 shown.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a high-yield pyocyanin engineering bacterium and a construction method and application thereof, and belongs to the field of gene engineering. The pseudomonas aeruginosa acyl carrier protein coding gene Pa acpP is replaced with the escherichia coli acyl carrier protein coding gene Ec acpP through a gene homologous recombination technology, so that the ability of the mutant strain to produce pyocyanin is improved by 4-5 times higher than that of the wild type strain. The engineering strain is provided for construction and breeding production of pyocyanin or related secondary metabolites thereof, such as genetically engineered bacteria of phenazine-1-carboxylic acid and large-scale production of pyocyanin and related secondary metabolites thereof.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a high-yield pyocyanin engineering bacterium and its construction method and application. Background technique [0002] Pyocyanin (PYO) is a phenazine virulence factor with redox ability secreted by Pseudomonas aeruginosa, which can be dissolved in chloroform, methanol and water. There are two forms of pyocyanin, oxidized state and reduced state. The oxidized state is blue when it is alkaline, and red when it is acidic; the reduced state is colorless, but it is an intermediate stage of redox under acidic conditions, and it is green. The conversion between its different ionic forms can interfere with intracellular redox reactions and affect the function of intracellular biomacromolecules. [0003] The vast majority of Pseudomonas aeruginosa strains isolated from the wild can produce pyocyanin, but the yield is low. As a virulence factor, pyocyanin can interact with...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/31C12N15/78C12N15/90C12N15/65C12P17/12C12R1/385
CPCC07K14/21C07K14/245C12N15/65C12N15/78C12N15/902C12P17/12
Inventor 王海洪张文彬马金成曹丹宋雨露
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap