Primers, method and test kit for detecting SNP site of gene PEAR1

A technology of PEAR1-CX-R and PEAR1-CX-F, which is applied in the fields of life science and biology, can solve the problems of high requirements for reaction conditions, cumbersome test process, and complicated operation process, so as to achieve simple and flexible operation and avoid false positives problem, reproducible effect

Inactive Publication Date: 2020-11-06
FUZHOU ADICON CLINICAL LAB INC
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

RFLP does not require high equipment, but the operation process is complicated, and false negative errors are prone to occur; AS-PCR has high requirements on primer design and PCR reaction conditions, and false positive errors are prone to occur; although the direct sequencing method has accurate results, the test process is cumbersome. higher cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers, method and test kit for detecting SNP site of gene PEAR1
  • Primers, method and test kit for detecting SNP site of gene PEAR1
  • Primers, method and test kit for detecting SNP site of gene PEAR1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] A kit for detecting the SNP site rs12566888 of the PEAR1 gene in a subject using HRM technology, including:

[0047] The sample DNA extraction reagent can be configured by yourself, or a ready-made kit can be purchased, such as the sample DNA extraction kit from QIAGEN.

[0048] HRM PCR reaction solution,

[0049] Standards and Negative Controls,

[0050] The HRM PCR reaction solution includes a pair of primers (PEAR1-HRM-F and PEAR1-HRM-R) for detecting the rs12566888 site, 2×HRM Analysis PreMix (Tiangen Biochemical Technology Co., Ltd.) and ddH 2 O, the primers for detecting the rs12566888 site are:

[0051] PEAR1-HRM-F:CACAGCTTGTAAGACAGAGATAGG;

[0052] PEAR1-HRM-R:AACCCTAGTTCCTTGCTCGG;

[0053] The standard product is GG genotype, GT genotype and TT genotype DNA; negative control substance: normal saline or without any substance.

[0054] In order to verify the results of HRM technology detection samples, the direct sequencing method is used for sequencing. Dur...

Embodiment 2

[0062] (1) Use the blood / cell genomic DNA extraction kit (QIAGEN) to extract whole blood genomic DNA. The operation process is as follows:

[0063] 1) Add 20μl QIAGEN Protease (or proteinase K) to the bottom of a 1.5ml centrifuge tube.

[0064] 2) Add 200 μL plasma to the centrifuge tube.

[0065] 3) Add 200 μl Buffer AL and shake for 15 seconds. (Note: Do not add QIAGEN Protease or proteinase K directly to Buffer AL. If the sample size is large, increase QIAGEN Protease and Buffer AL proportionally.)

[0066] 4) Water bath at 56°C for 10 minutes, and then briefly centrifuge to remove the liquid on the inner edge of the centrifuge tube cover.

[0067] 5) Add 200 μl of ethanol (96%-100%), shake for 15 s, and centrifuge briefly to remove the liquid along the inner edge of the centrifuge tube cover.

[0068] 6) Carefully add the mixture obtained above (including the precipitate) into the QIAamp Mini spin column (do not wet the edge), put the spin column into a 2ml collection t...

Embodiment 3

[0113] Embodiment 3 clinical sample detection

[0114] Take 20 cases of clinical samples to be tested, extract DNA solution, prepare reagents and detect according to the method described in Example 2.

[0115] Add 1 μL of the DNA solution extracted from each clinical sample to the detection system PCR reaction solution. At the same time, make a copy of each standard product. Detect with a fluorescent PCR instrument, and the time is 60 minutes.

[0116] Such as figure 1 Shown are the Normalized Melting curves of standard TT, standard GT, and standard GG.

[0117] Such as figure 2 Shown are the Difference Melting curves for standard TT, standard GT, and standard GG.

[0118] Such as image 3 Shown are the Normalized Melting curves for samples #1, #5, #14 and the standard.

[0119] Such as Figure 4 Shown are the Difference Melting curves for samples #1, #5, #14 and the standard.

[0120] According to the HRM results, the genotypes at the PEAR1 rs12566888 locus of 20 sc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides primers, a method and a test kit for detecting an SNP site rs12566888 of a gene PEAR1 by utilizing a high-resolution melting curve technology. According to the invention, the polymorphism of the site rs12566888 of the gene PEAR1 is detected; standard samples (a genotype GG, a genotype GT and a genotype TT) are screened out from peripheral blood DNA samples by adopting a direct sequencing method; an HRM detection result is verified by adopting the direct sequencing method; and thus, the primers, the method and the test kit can be used for assisting clinical aspirin medication and is helpful for preventing various adverse reactions in an aspirin medication period.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and relates to a gene polymorphism detection method for clinical testing purposes, a kit and the primers used therefor, which detect the SNP site of the PEAR1 gene related to aspirin medication in patients by using HRM technology rs12566888. Background technique [0002] Aspirin is a widely used drug. In addition to its antipyretic, analgesic and anti-inflammatory effects, it also has antiplatelet effects. Its mechanism of action is to directly and irreversibly inhibit cyclooxygenase (COX-1 and COX-2), reduce Synthesis of prostaglandins, inhibition of platelet synthesis of thromboxane A2 (TXA2), thereby inhibiting platelet aggregation. Aspirin can also inhibit platelet aggregation and release reactions and spontaneous aggregation caused by low concentrations of collagen, thrombin, antigen-antibody complexes, etc., thus playing a role in preventing thrombosis. Clinical studies have ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6883C12Q1/6858C12N15/11
CPCC12Q1/6883C12Q1/6858C12Q2600/106C12Q2600/156C12Q2600/166C12Q2531/113C12Q2527/107C12Q2545/113C12Q2563/107C12Q2535/101
Inventor刘赵玲牛林梅王淑一
OwnerFUZHOU ADICON CLINICAL LAB INC