Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for preparing hexanediol through whole-cell catalysis of genetically engineered bacteria

A technology of genetically engineered bacteria and whole-cell catalysts, applied in genetic engineering, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of product contamination, harsh reaction conditions, soaring prices of HDO-related products, etc., and achieve production efficiency. High and low use effects

Active Publication Date: 2021-03-09
NANJING SHENGDE INST OF BIOTECHNOLOGY CO LTD +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The biggest advantage of the chemical method is that the reaction efficiency is high, and the substrate loading and yield are generally higher than those of the enzymatic method. However, harsh reaction conditions will be used in the production process, and toxic and harmful catalyst additives will also pollute the product.
In addition, under the supervision of increasingly stringent environmental protection laws, the cost pressure and public opinion pressure encountered by chemical method production are also increasing.
Because of this, the multinational chemical giant BASF closed down the U.S. factory that produced HDO, which indirectly caused the prices of HDO-related products to soar.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing hexanediol through whole-cell catalysis of genetically engineered bacteria
  • Method for preparing hexanediol through whole-cell catalysis of genetically engineered bacteria
  • Method for preparing hexanediol through whole-cell catalysis of genetically engineered bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1 A kind of method for preparing the genetically engineered bacteria of SMO enzyme

[0039] Primers were designed according to the sequence of the SMO gene of Pseudomonas putida:

[0040] Forward primer: GGGAATTCCATATGatgaaaaagcgtatcggtattgttg, the underlined sequence is the enzyme cutting site NdeI.

[0041] Reverse primer: CGAGCTCggccgcaatagtgggtgcgtactggct, the underlined sequence is the SacI restriction site. The sequence number of the gene product is ABX24519.1.

[0042] The two ends of the gene sequence obtained by PCR have NdeI and SacI sites, and the gene is inserted into the pET30a vector, and the high-expression genetic engineering vector plasmid obtained is named pET30SMO, and then the high-expression vector is transformed into the recipient strain Escherichia coli In BL21(DE3), a genetically engineered bacterium with high SMO enzyme production was obtained, and the protein expressed by the obtained genetically engineered bacterium had a His-Tag ...

Embodiment 2

[0052] Embodiment 2 A kind of method for preparing the genetically engineered bacteria of FAD enzyme

[0053] Primers were designed according to the sequence of the FAD gene of Pseudomonas putida:

[0054] Forward primer: GGGAATTCCATATGgtgattcaaatgacgttaaaaaa, the underlined sequence is the enzyme cutting site NdeI.

[0055] Reverse primer: CGAGCTCattcagcggcaacgggttgccgtgataac, the underlined sequence is the SacI restriction site. The sequence number of the gene product is ABX24520.1.

[0056] The two ends of the gene sequence obtained by PCR have NdeI and SacI sites, and the gene is inserted into the pET30a vector, and the high-expression genetic engineering vector plasmid obtained is named pET30FAD, and then the high-expression vector is transformed into the recipient strain Escherichia coli In BL21(DE3), a genetically engineered bacterium with high FAD enzyme production was obtained, and the protein expressed by the obtained genetically engineered bacterium had a His-Tag ...

Embodiment 3

[0062] Embodiment 3 A kind of method for preparing the genetically engineered bacteria of GDH enzyme

[0063] Primers were designed according to the sequence of the GDH gene of Bacillus megaterium:

[0064] Forward primer: GGGAATTCCATATGATGTATACAGATTTAAAAGATAA, the underlined sequence is the enzyme cutting site NdeI.

[0065] Reverse primer: CGAGCTCGCCTCTTCCTGCTTGGAAA, the underlined sequence is the SacI restriction site. The sequence number of the gene product is AJI21421.1.

[0066] The two ends of the gene sequence obtained by PCR have NdeI and SacI sites, and the gene is inserted into the pET30a vector, and the high-expression genetic engineering vector plasmid obtained is named pET30GDH, and then the high-expression vector is transformed into the recipient strain Escherichia coli In BL21(DE3), a genetically engineered bacterium with high FAD enzyme production was obtained, and the protein expressed by the obtained genetically engineered bacterium had a His-Tag tag prote...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing hexanediol through whole-cell catalysis of genetically engineered bacteria, and relates to the technical field of biological catalysis. According to thetechnical scheme, three genetically engineered bacteria of SMO, FAD and EH are mainly used for whole-cell catalysis or four genetically engineered bacteria of SMO, FAD, GDH and EH are used for whole-cell mixed catalysis of substrates of n-hexene, and hydrolysis is performed to finally obtain the hexanediol. According to the technical scheme, the method for generating the hexanediol has the characteristics of mild reaction, small pollution, no generation of toxic by-products, high conversion rate, high production efficiency, low production cost and the like.

Description

technical field [0001] The invention relates to the technical field of biocatalysis, more specifically, it relates to a method for preparing hexylene glycol by catalyzing whole cells of genetically engineered bacteria. Background technique [0002] 1,2-Hexanediol (Cas No: 6920-22-5) is a colorless, transparent liquid with a pungent odor. It has unique properties and can be mixed with various organic compounds in any proportion without corrosiveness. Hexylene glycol can also be derived from a series of new fine chemicals, which are widely used in the manufacture of advanced cosmetics, multi-purpose advanced cleaners, and color inkjet printer inks. In addition, ethylene glycol can also be used in high-grade ink, high-grade paint, coating, high-grade glue, binder solvent and softener, and can produce 1,2-adipic acid and amino alcohol and other products. [0003] In recent years, due to the excellent properties of 1,2-hexanediol, it has been widely used in cosmetics and some da...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P7/18C12N1/21C12N15/70C12N15/53C12N15/55C12R1/19
CPCC12P7/18C12N1/20C12N15/70C12N15/52C12N9/0071C12N9/0028C12N9/0006C12N9/14C12Y105/0103C12Y101/03004C12Y303/02003
Inventor 史鲁秋汪昌国薛虹宇苏桂珍其他发明人请求不公开姓名
Owner NANJING SHENGDE INST OF BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com