BCG_0349 gene-deleted recombinant bacillus calmette-guerin vaccine as well as construction method and application thereof
A technology of recombinant BCG and gene deletion, applied in the direction of microorganism-based methods, applications, genetic engineering, etc., can solve the problems of accelerating tuberculosis, not superior to BCG, and unable to achieve immune protection functions, etc., to achieve the goal of promoting the secretion of inflammatory cytokines Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] Example 1: Construction of BCGΔBCG_0349 gene deletion strain and complementation strain
[0063] 1.1 Construction of homologous exchange substrate
[0064] Refer to the whole genome sequence of Mycobacterium tuberculosis variant bovis BCG str.Pasteur1173P2 BCG Pasteur strain in GenBank, use the whole genome of BCG Pasteur strain as a template, and use the primers designed as follows (SEQ ID NO: 2-5 in the sequence table) to obtain BCG_0349 The upstream and downstream homology arms of the gene. The left and right homology arms were amplified by PCR using a high-fidelity DNA polymerase, respectively.
[0065] The sequences of primers for the upstream and downstream homology arms of BCG_0349 are as follows:
[0066] a, upstream homology arm forward primer (SEQ ID NO: 2) BCG_0349-LF:
[0067] TTTTTTTT CCATAAATTGG TGTTTCGCTCGCTTTTGTCG underlined is the restriction site of Van91I.
[0068] b, upstream homology arm reverse primer (SEQ ID NO: 3) BCG_0349-LR:
[0069] TTTTT...
Embodiment 2
[0116] Example 2: In vitro growth characteristics of BCGΔBCG_0349 deletion strain
[0117] 2.1 Determination of growth curve of BCGΔBCG_0349 deletion strain
[0118] Take Mycobacterium bovis BCG wild strain, anaplerotic strain and deletion strain BCGΔBCG_0349 to inoculate 7H9 liquid medium at a ratio of 1:100 (volume ratio), and place it at 37°C, 5% CO 2 Continuous culture in the incubator for 60 days, take appropriate bacterial solution every 3 days to measure OD 600 value, such as Image 6 As shown, there was no significant statistical difference in the growth rates of the three strains under in vitro culture conditions. Show that BCG_0349 gene does not affect the growth rate of bacteria.
[0119] 2.2 Morphological observation of the deletion strain BCGΔBCG_0349
[0120] The Mycobacterium bovis BCG wild strain, complementing strain and deletion strain cultivated to the end of the logarithm were diluted to appropriate multiples, spread on 7H11 solid medium, and kept at 37...
Embodiment 3
[0121] Example 3: Detection of the ability of BCGΔBCG_0349 deletion strain to induce expression of inflammatory factors
[0122] 3.1 Detection of the ability of BCGΔBCG_0349 deletion strain to regulate the secretion of inflammatory cytokines in macrophages at the cellular level
[0123] 2×10 per well 5 Cells were inoculated with mouse monocyte-macrophage RAW264.7 cells in a 12-well plate at 37°C, 5% CO 2 Culture until adherence; RAW264.7 cells were infected with deletion strain, complementation strain and wild strain at an infection ratio of 10:1 (MOI=10:1). 37°C, 5% CO 2 Incubate in an incubator for 2 hours, discard the liquid in the well, add phosphate buffer (0.01M, pH 7.4PBS) to wash thoroughly 3 times, add medium containing 100μg / ml gentamicin to kill extracellular bacteria, and then place 37°C, 5% CO 2 Cultured in the incubator, this time was recorded as infection 0h. Cell culture supernatants were collected at 0, 2, 4, 8, 24, and 48 hours after infection for detect...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com