Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

BCG_0349 gene-deleted recombinant bacillus calmette-guerin vaccine as well as construction method and application thereof

A technology of recombinant BCG and gene deletion, applied in the direction of microorganism-based methods, applications, genetic engineering, etc., can solve the problems of accelerating tuberculosis, not superior to BCG, and unable to achieve immune protection functions, etc., to achieve the goal of promoting the secretion of inflammatory cytokines Effect

Active Publication Date: 2021-03-12
HUAZHONG AGRI UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, although BCG vaccine has saved tens of thousands of lives, for many special groups, especially immunocompromised groups (such as AIDS patients), BCG vaccine not only fails to realize its immune protection function, but accelerates the occurrence of tuberculosis
In order to solve this problem, more and more scholars are committed to developing a safer and more effective tuberculosis vaccine, but there is still no vaccine superior to BCG

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • BCG_0349 gene-deleted recombinant bacillus calmette-guerin vaccine as well as construction method and application thereof
  • BCG_0349 gene-deleted recombinant bacillus calmette-guerin vaccine as well as construction method and application thereof
  • BCG_0349 gene-deleted recombinant bacillus calmette-guerin vaccine as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1: Construction of BCGΔBCG_0349 gene deletion strain and complementation strain

[0063] 1.1 Construction of homologous exchange substrate

[0064] Refer to the whole genome sequence of Mycobacterium tuberculosis variant bovis BCG str.Pasteur1173P2 BCG Pasteur strain in GenBank, use the whole genome of BCG Pasteur strain as a template, and use the primers designed as follows (SEQ ID NO: 2-5 in the sequence table) to obtain BCG_0349 The upstream and downstream homology arms of the gene. The left and right homology arms were amplified by PCR using a high-fidelity DNA polymerase, respectively.

[0065] The sequences of primers for the upstream and downstream homology arms of BCG_0349 are as follows:

[0066] a, upstream homology arm forward primer (SEQ ID NO: 2) BCG_0349-LF:

[0067] TTTTTTTT CCATAAATTGG TGTTTCGCTCGCTTTTGTCG underlined is the restriction site of Van91I.

[0068] b, upstream homology arm reverse primer (SEQ ID NO: 3) BCG_0349-LR:

[0069] TTTTT...

Embodiment 2

[0116] Example 2: In vitro growth characteristics of BCGΔBCG_0349 deletion strain

[0117] 2.1 Determination of growth curve of BCGΔBCG_0349 deletion strain

[0118] Take Mycobacterium bovis BCG wild strain, anaplerotic strain and deletion strain BCGΔBCG_0349 to inoculate 7H9 liquid medium at a ratio of 1:100 (volume ratio), and place it at 37°C, 5% CO 2 Continuous culture in the incubator for 60 days, take appropriate bacterial solution every 3 days to measure OD 600 value, such as Image 6 As shown, there was no significant statistical difference in the growth rates of the three strains under in vitro culture conditions. Show that BCG_0349 gene does not affect the growth rate of bacteria.

[0119] 2.2 Morphological observation of the deletion strain BCGΔBCG_0349

[0120] The Mycobacterium bovis BCG wild strain, complementing strain and deletion strain cultivated to the end of the logarithm were diluted to appropriate multiples, spread on 7H11 solid medium, and kept at 37...

Embodiment 3

[0121] Example 3: Detection of the ability of BCGΔBCG_0349 deletion strain to induce expression of inflammatory factors

[0122] 3.1 Detection of the ability of BCGΔBCG_0349 deletion strain to regulate the secretion of inflammatory cytokines in macrophages at the cellular level

[0123] 2×10 per well 5 Cells were inoculated with mouse monocyte-macrophage RAW264.7 cells in a 12-well plate at 37°C, 5% CO 2 Culture until adherence; RAW264.7 cells were infected with deletion strain, complementation strain and wild strain at an infection ratio of 10:1 (MOI=10:1). 37°C, 5% CO 2 Incubate in an incubator for 2 hours, discard the liquid in the well, add phosphate buffer (0.01M, pH 7.4PBS) to wash thoroughly 3 times, add medium containing 100μg / ml gentamicin to kill extracellular bacteria, and then place 37°C, 5% CO 2 Cultured in the incubator, this time was recorded as infection 0h. Cell culture supernatants were collected at 0, 2, 4, 8, 24, and 48 hours after infection for detect...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene-deleted recombinant bacillus calmette-guerin vaccine, and belongs to the technical field of zoonosis prevention and treatment. The gene deleted by the strain is a BCG_0349 gene with a nucleotide sequence shown as SEQ ID NO: 1. A homologous exchange substrate containing upstream and downstream homologous arms of the BCG_0349 gene is transduced into a bacillus calmette-guerin vaccine genome in a thermo-sensitive phage transducing mediated homologous recombination mode to knock out the BCG_0349 gene, the strain is successfully constructed, and it is confirmed for the first time that a deleted strain can promote expression and secretion of inflammatory cytokines of the organism and is weakened in toxicity; and specifically, the reduction of the forming ability ofthe soxhlet structure and the reduction of the phenotype and intracellular survival ability of small bacterial colonies are easier for removal of organisms, and the vaccine has good application potential in the related fields of tuberculosis diagnosis of human and animals, vaccine and drug development and the like.

Description

technical field [0001] The invention belongs to the technical field of prevention and treatment of zoonoses, and relates to BCG, in particular to a gene-deleted recombinant BCG, and also relates to a construction method and application of the strain. Background technique [0002] Bovine tuberculosis is a chronic consumptive zoonotic disease that occurs in a variety of animals and humans, and has brought huge economic losses to the world's cattle industry and public health. Mycobacterium bovis (M.bovis) is the main pathogenic bacterium that causes bovine tuberculosis, and it has 99.95% homology at the gene level with the main pathogenic bacterium of human tuberculosis, Mycobacterium tuberculosis (M.tb) , so the infection spectrum crosses each other, and both can infect almost all vertebrates, including humans. For this reason, the only official vaccine currently used to prevent human tuberculosis is an attenuated strain of Mycobacterium bovis - Mycobacterium bovis Bacille Ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/31A61K39/04A61P31/04C12R1/32
CPCC07K14/35A61K39/04A61P31/04
Inventor 陈颖钰彭永崇郭爱珍高霖胡长敏陈焕春
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com