Strain combination for producing sclareol, application and method for producing sclareol

A technology of sclareol and sclareol, which is applied in the field of synthetic biology, can solve the problems of long growth cycle of sclare, influence on aroma characteristics, and great influence of environmental factors, so as to promote the production of sclareol by yeast. Effect

Active Publication Date: 2021-03-30
ZHEJIANG UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main problems of this synthetic route include: obtaining sclareol from Sclareus as raw material requires steps such as extraction and purification, and the growth cycle of Sclareus is long and greatly affected by environmental factors; the current chemical synthesis method or route is long , or the synthesis process requires expensive reagents, or there are three wastes in some processes (Moulines J, Jean-PaulBats, Anne-Marie Lamidey, et al.About a Practical Synthesis of Ambrox from Sclareol: a New Preparation of a Ketone Key Intermediate and a Close Look atits Baeyer–Villiger Oxidation[J].ChemInform,2005,36(87):2695-2705.); In addition, (-)-Ambrox as a flavoring agent and fixative, can replace natural ambergris , used in high-end perfumes and cigarettes, (-)-Ambrox produced by chemical methods may have residual chemical impurities that will affect the aroma characteristics and the safety of its application
However, there is no relevant research on the production of sclarediol by biological methods directly using glucose as a carbon source

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Strain combination for producing sclareol, application and method for producing sclareol
  • Strain combination for producing sclareol, application and method for producing sclareol
  • Strain combination for producing sclareol, application and method for producing sclareol

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: Construction of Sclareol-producing Saccharomyces cerevisiae strain

[0025] Using codon optimization software, the codons of lysandene diol pyrophosphate synthase (GenBank No.: JN133923.1) and sclareol synthase (GenBank No.: JN133922) from Salvia miltiorrhiza were codified with Saccharomyces cerevisiae as the host sub-optimization, and artificially synthesize the optimized sequence. The genes were truncated through the signal peptide online prediction website, namely OtSsLPPs3 and OtSsTPs1132. Use the following primers:

[0026] OtTpsSa3-BamHI-F: GGATCCATGGCTTCACAAGCATCAGAAAA;

[0027] OtTpsSa3-XhoI-R: CTCGAGTTAAACAACTGGTCTAAACAAAACT;

[0028] OtSsTps1132-EcoRI-F:GAATTCATGATGGCTAAAATGAAAGAAAATTT;

[0029] OtSsTps1132-SpeI-R: ACTAGTTTAAAAAAAAAAAGATTTCATATCTTCT, the optimized truncated OtSsLPPs3 (nucleotide sequence such as SEQ ID NO.1) and OtSsTPs1132 (nucleotide sequence such as SEQ ID NO.2) were cloned into the yeast integrative plasmid pUMRI-10 ( figu...

Embodiment 2

[0041] Embodiment 2: the method that fungus ATCC 20624 is cultivated alone to produce sclareol:

[0042] The first step: the fungal ATCC 20624 seed liquid expansion culture. Pick a single colony of the fungus ATCC 20624 from the YPD plate and insert it into a 100 mL shake flask containing 20 mL of YPD. Cultivate for 48 hours at 25° C. on a shaker with a rotational speed of 180 rpm to obtain fungal ATCC20624 seed liquid.

[0043] The second step: the fungus ATCC 20624 was inoculated into 50 mL of YPD medium with a 4% (v / v) inoculum amount, and 0.2 g / L sclareol was added at the same time. Incubate at 25° C. for 72 h on a shaker with a rotational speed of 180 rpm.

[0044] Step 3: After the cultivation, take 1 mL of fermentation broth, add an equal volume of ethyl acetate, vortex, and sonicate in an ultrasonic cleaner for 10 minutes to thoroughly extract the sclarediol in the fermentation broth. After sonication, centrifuge at 12000×g for 5 min to take 500 μL of organic phase,...

Embodiment 3

[0045] Example 3: Establishment of co-cultivation system of Saccharomyces cerevisiae genetic engineering strain and fungus ATCC 20624

[0046] The first step: YN02 strain seed liquid expansion culture. A single colony of Saccharomyces cerevisiae producing sclareol was picked from the YPD plate and inserted into a test tube containing 5 mL of YPD liquid, and cultured at 30° C. for 12 hours on a shaker with a rotation speed of 220 rpm to obtain yeast seed liquid.

[0047] The second step: fungal ATCC 20624 seed liquid expansion culture. Pick a single colony of the fungus ATCC 20624 from the YPD plate and insert it into a 100 mL shake flask containing 20 mL of YPD. Cultivate at 24° C. for 48 hours on a shaker with a rotating speed of 180 rpm to obtain fungal ATCC20624 seed liquid.

[0048] Step 3: S. cerevisiae at initial OD 600 The seed solution was inoculated into 50 mL of YPD fermentation medium with an inoculation amount of 0.05, and cultured on a shaker at 30° C. with a r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a strain combination for producing sclareol, an application and a method for producing sclareol. The strain combination for producing sclareol is composed of saccharomyces cerevisiae engineering bacteria and fungi with the preservation number of ATCC 20624, and the saccharomyces cerevisiae engineering bacteria externally express lysimachidonediol pyrophosphate synthase andsclareol synthase. Compared with the prior art, the saccharomyces cerevisiae has the remarkable advantages that 1, a precursor GGPP for synthesizing sclareol can be provided by a metabolic pathway ofthe saccharomyces cerevisiae, a microbial synthesis method of the sclareol can be realized by introducing two exogenous genes, and a raw material is provided for producing sclareol; 2, in a co-culturesystem, the fungus ATCC 20624 takes sclareol generated by yeast as a substrate and converts the sclareol into sclareol, so that de novo biosynthesis of sclareol can be realized, and 3, the fungus ATCC 20624 converts the sclareol, so that the yeast can be further promoted to produce the sclareol.

Description

technical field [0001] The invention relates to the technical field of synthetic biology, in particular to a strain combination for producing sclarediol, its application and a method for producing sclarediol. Background technique [0002] Sclareol glycol is an important intermediate in the synthesis of (-)-Ambrox ((-)-ambrox). Ambrox is considered to be the odor prototype of natural animal fragrance ambergris, which has a unique mild, delicate and pleasant musky animal fragrance, which best embodies the characteristics of ambergris. At present, the industrial production method of (-)-Ambrox is mainly based on the semi-synthetic route of sclareol as raw material, and the sclareol (Sclareol) extracted from the plant Sclareus (Salvia sclarea) has and (-)-Ambrox has a similar carbon skeleton. Oxidation of the side chain of sclareol by oxidant to produce sclareolide, then reduction to produce sclareolide, and finally dehydration and cyclization under acidic conditions to produc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/19C12N1/14C12N15/81C12P39/00C12P7/02C12R1/865C12R1/645
CPCC12N1/14C12N9/88C12N15/81C12P39/00C12P7/02C12Y402/03
Inventor于洪巍叶丽丹何霓
OwnerZHEJIANG UNIV