Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of dihydropterin aldolase gene

A kind of technology of aldolase and dihydroptere, which is applied in the field of microbial gene application, can solve the problems of high extraction and purification costs, poor strain stability, and low folic acid synthesis

Inactive Publication Date: 2021-05-14
KUNMING UNIV OF SCI & TECH
View PDF13 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, under normal circumstances, the folic acid synthesis of lactic acid bacteria is generally not high, and the strain stability is poor, and factors such as high extraction and purification costs restrict the large-scale application of lactic acid bacteria folic acid in industrial production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of dihydropterin aldolase gene
  • Application of dihydropterin aldolase gene
  • Application of dihydropterin aldolase gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] Example 1: Dihydropterin Aldolase (DHNA) Gene fol clone of B

[0016] The total genome DNA of Lactobacillus plantarum YM-4-3 was extracted by CTAB / enzyme method, and the following primers were used for the gene fol B carries out PCR amplification;

[0017] BDB-F: ATACCCGGGCATGGGCATGATTCGAATTA;

[0018] BDB-R: CCCAAGCTTCTACTTGCCATTCGGCGTCC;

[0019] The PCR amplification system is as follows (50 μL):

[0020] ;

[0021] PCR amplification conditions: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s; annealing at 60°C for 15 s; extension at 72°C for 30 s; cycle 30 times, and finally extension at 72°C for 10 min; the amplified PCR products were sequenced and compared. The sequencing results showed that a 369bp long sequence was obtained, and the nucleotide sequence was shown as SEQ ID NO: 1.

Embodiment 2

[0022] Example 2: Construction of an expression vector using the plasmid pMG36e as the backbone

[0023] 1. The target gene amplified in Example 1 fol Fragment B and pMG36e plasmid Hind Ⅲ、 Xma Ⅰ two restriction endonucleases for digestion, the digestion system is as follows:

[0024]

[0025] After digestion at 37°C for 4 hours, 2% agarose gel electrophoresis was used for identification, and the enzyme digestion product was recovered by referring to the instructions of the gel recovery kit, and stored at -20°C.

[0026] 2. Enzyme digestion product connection

[0027] After purification, the digested product was ligated with T4 ligase, and ligated overnight at 16°C. The ligation system (10 μL) was as follows:

[0028] ;

[0029] 3. Transformation of the ligation product into Escherichia coli DH5α strain and verification

[0030] 1) Take out the prepared competent E. coli DH5α from the -80°C refrigerator, and after thawing on ice, add all the ligation products that ...

Embodiment 3

[0041] Embodiment 3: expression vector transformation YM-4-3 bacterial strain competent cell

[0042] 1. Preparation of YM-4-3 strain competent cells

[0043] YM-4-3 strain was thawed and inoculated into MRS broth medium at 4‰ inoculum, cultured at 37°C for 12 hours, inoculated 1 mL into 50 mL MRS broth medium containing 2.5% glycine, and cultivated to its OD 600 When the value reached 0.6, the culture was stopped, and the bacterial liquid was collected by centrifugation at 4°C and 4000 rpm / min for 10 min; washed twice with 25 mL of ice-cold sterile water, centrifuged again, discarded the supernatant, and resuspended the bacteria in 0.05 mol / L ice-cold In EDTA solution, ice-bath for 5 min, then add 25 mL of ice-cold sterile water, centrifuge at 4 °C, 8000 rpm / min for 5 min, then wash with 25 mL of ice-cold sterile water, and use 25 mL of shock buffer (0.5 mol / L sucrose, 10% glycerol), centrifuge at 4°C, 8000 rpm / min for 10min, repeat once; resuspend the bacteria in 0.8mL shoc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a new application of a dihydropterin aldolase gene folB, namely an application of the dihydropterin aldolase gene folB in improvement of folic acid synthesis of lactobacillus plantarum, and the nucleotide sequence of the dihydropterin aldolase gene folB is shown as SEQ ID NO: 1; the method comprises the following steps: recombining a folB gene and a pMG36e plasmid to construct an overexpression vector, and introducing the overexpression vector into a food-borne lactobacillus plantarum competent cell to obtain a folB gene overexpression strain BDB; an LC-MS method is adopted to measure the folic acid producing capacity of the strain, it is found that compared with a wild type strain, the folic acid producing amount of the BDB strain is remarkably increased, the folB gene plays a key role in folic acid synthesis, and the method has huge potential in the folic acid biosynthesis research and application field.

Description

technical field [0001] The invention belongs to the field of microbial gene application, in particular to dihydropterin aldolase gene fol B in improving Lactobacillus plantarum ( Lactobacillus plantarum ) application in folic acid synthesis. Background technique [0002] Many researchers have reported that lactic acid bacteria, such as Lactobacillus acidophilus, Lactococcus lactis, Streptococcus thermophilus and Leuconostoc, have the ability to synthesize folic acid. The ability of different lactic acid bacteria to produce folic acid is significantly different, ranging from 2 to 214 μg / L. The ability of the applied strain to produce and consume folic acid may be one of the important factors determining the level of folic acid. [0003] Folic acid, also known as pteroylglutamic acid (PGA), is a general term for water-soluble compounds in B vitamins. Folate is an essential trace element in the human diet and is involved in many metabolic pathways, mainly in carbon transfer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/60C12N15/74C12R1/25
CPCC12N9/88C12N15/74C12Y401/02025
Inventor 柳陈坚王若曦李晓然
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com