Application of dihydropterin aldolase gene
A kind of technology of aldolase and dihydroptere, which is applied in the field of microbial gene application, can solve the problems of high extraction and purification costs, poor strain stability, and low folic acid synthesis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0015] Example 1: Dihydropterin Aldolase (DHNA) Gene fol clone of B
[0016] The total genome DNA of Lactobacillus plantarum YM-4-3 was extracted by CTAB / enzyme method, and the following primers were used for the gene fol B carries out PCR amplification;
[0017] BDB-F: ATACCCGGGCATGGGCATGATTCGAATTA;
[0018] BDB-R: CCCAAGCTTCTACTTGCCATTCGGCGTCC;
[0019] The PCR amplification system is as follows (50 μL):
[0020] ;
[0021] PCR amplification conditions: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s; annealing at 60°C for 15 s; extension at 72°C for 30 s; cycle 30 times, and finally extension at 72°C for 10 min; the amplified PCR products were sequenced and compared. The sequencing results showed that a 369bp long sequence was obtained, and the nucleotide sequence was shown as SEQ ID NO: 1.
Embodiment 2
[0022] Example 2: Construction of an expression vector using the plasmid pMG36e as the backbone
[0023] 1. The target gene amplified in Example 1 fol Fragment B and pMG36e plasmid Hind Ⅲ、 Xma Ⅰ two restriction endonucleases for digestion, the digestion system is as follows:
[0024]
[0025] After digestion at 37°C for 4 hours, 2% agarose gel electrophoresis was used for identification, and the enzyme digestion product was recovered by referring to the instructions of the gel recovery kit, and stored at -20°C.
[0026] 2. Enzyme digestion product connection
[0027] After purification, the digested product was ligated with T4 ligase, and ligated overnight at 16°C. The ligation system (10 μL) was as follows:
[0028] ;
[0029] 3. Transformation of the ligation product into Escherichia coli DH5α strain and verification
[0030] 1) Take out the prepared competent E. coli DH5α from the -80°C refrigerator, and after thawing on ice, add all the ligation products that ...
Embodiment 3
[0041] Embodiment 3: expression vector transformation YM-4-3 bacterial strain competent cell
[0042] 1. Preparation of YM-4-3 strain competent cells
[0043] YM-4-3 strain was thawed and inoculated into MRS broth medium at 4‰ inoculum, cultured at 37°C for 12 hours, inoculated 1 mL into 50 mL MRS broth medium containing 2.5% glycine, and cultivated to its OD 600 When the value reached 0.6, the culture was stopped, and the bacterial liquid was collected by centrifugation at 4°C and 4000 rpm / min for 10 min; washed twice with 25 mL of ice-cold sterile water, centrifuged again, discarded the supernatant, and resuspended the bacteria in 0.05 mol / L ice-cold In EDTA solution, ice-bath for 5 min, then add 25 mL of ice-cold sterile water, centrifuge at 4 °C, 8000 rpm / min for 5 min, then wash with 25 mL of ice-cold sterile water, and use 25 mL of shock buffer (0.5 mol / L sucrose, 10% glycerol), centrifuge at 4°C, 8000 rpm / min for 10min, repeat once; resuspend the bacteria in 0.8mL shoc...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com