Gene editing system for constructing high-quality porcine nuclear transplantation donor cells with high fecundity and resistance to porcine reproductive and respiratory syndrome and series diarrhea diseases and application of gene editing system

A gene editing and gene technology, applied in the direction of receptor/cell surface antigen/cell surface determinant, plant gene improvement, genetically modified cells, etc., can solve the problems of receptor protein inactivation, pig infectivity reduction, etc., to achieve High fecundity, low cloning efficiency, low cloning and feeding costs

Pending Publication Date: 2021-06-01
NANJING KGENE GENETIC ENG CO LTD
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Destroying the pAPN gene will inactivate the receptor protein encoded by it, TGEV virus cannot infect live pigs, and the infectivity of PEDV and PDCoV to pigs is also greatly reduced

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene editing system for constructing high-quality porcine nuclear transplantation donor cells with high fecundity and resistance to porcine reproductive and respiratory syndrome and series diarrhea diseases and application of gene editing system
  • Gene editing system for constructing high-quality porcine nuclear transplantation donor cells with high fecundity and resistance to porcine reproductive and respiratory syndrome and series diarrhea diseases and application of gene editing system
  • Gene editing system for constructing high-quality porcine nuclear transplantation donor cells with high fecundity and resistance to porcine reproductive and respiratory syndrome and series diarrhea diseases and application of gene editing system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0089] Embodiment 1, the construction of plasmid

[0090] 1.1 Construction of plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO (plasmid pKG-GE3 for short)

[0091] The sequence of the original plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (abbreviated as plasmid pX330) is shown in SEQ ID NO.1. The schematic diagram of the structure of plasmid pX330 is shown in figure 1 . In SEQ ID NO.1, the 440-725 nucleotides form the CMV enhancer, the 727-1208 nucleotides form the chicken β-actin promoter, and the 1304-1324 nucleotides encode the SV40 nuclear localization signal ( NLS), the 1325-5449th nucleotide encodes the Cas9 protein, and the 5450-5497th nucleotide encodes the nucleoplasmin nuclear localization signal (NLS).

[0092] Plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO ( Figure 5 ), referred to as plasmid pKG-GE3, the nucleotide is shown in SEQ ID NO.2. Compared with the plasmid pX330, the plasmid pKG-GE3 has been mainly modified as follows: ① Remove the residual gRNA backbone sequ...

Embodiment 2

[0105] Example 2 Plasmid Proportion Optimization and Effect Comparison of Plasmid pX330 and Plasmid pKG-GE3

[0106] 2.1 Target gRNA design and construction

[0107] 2.1.1 Using Benchling to design target gRNA for RAG1 gene

[0108] RAG1-g4: AGTTATGGCAGAACTCAGTG (SEQ ID NO. 9)

[0109] Synthesize complementary DNA Oligo for the insertion sequence of the above-mentioned RAG1 gene target as follows:

[0110] RAG1-gRNA4S: caccgAGTTATGGCAGAACTCAGTG (SEQ ID NO.10)

[0111] RAG1-gRNA4A: aaacCACTGAGTTCTGCCATAACTc (SEQ ID NO.11)

[0112] Both RAG1-gRNA4S and RAG1-gRNA4A are single-stranded DNA molecules.

[0113] 2.1.2 Primers designed to amplify and detect fragments containing the RAG1 gRNA target

[0114] RAG1-nF126: CCCCATCCAAAGTTTTTAAAGGA

[0115] RAG1-nR525: TGTGGCAGATGTCACAGTTTAGG

[0116] 2.1.3 Construction and cloning of gRNA recombinant vector

[0117] 1) Digest 1ug pKG-U6gRNA plasmid with restriction endonuclease BbsI;

[0118] 2) run the digested pKG-U6gRNA plasmid...

Embodiment 3

[0165] Example 3 Screening of efficient INHA gene gRNA targets

[0166]Pig INHA gene information: encodes inhibin subunit alpha protein; located on pig chromosome 5; GeneID is 397386, Sus scrofa. The protein encoded by the pig INHA gene is shown in GENBANK ACCESSION NO.XP_020930352.1 (linear CON 12-JAN-2018), and the amino acid sequence is shown in SEQ ID NO.13. In the genomic DNA, the porcine INHA gene has two exons, wherein the second exon and its upstream and downstream sequences of 100 bp are shown in SEQ ID NO.14.

[0167] 3.1 INHA gene knockout predetermined target and conservation analysis of adjacent genome sequences

[0168] 18 newborn Congjiang pigs, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) and 8 males (named A, B, C, D , E, F, G, H).

[0169] Using the genomic DNA of 18 pigs as a template, PCR amplification was performed using primer pairs (the target sequence of the primer pair includes exon 2 of the pig INHA gene), and then electrophoresis was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene editing system for high-quality porcine nuclear transplantation donor cells with high fecundity and resistance to porcine reproductive and respiratory syndrome and series diarrhea diseases and application of the gene editing system. The invention discloses a CRISPR / Cas9 system for pig INHA-CD163-pAPN gene editing. The CRISPR / Cas9 system comprises a Cas9 expression vector, a gRNA expression vector aiming at a pig INHA gene, a gRNA expression vector aiming at a pig CD163 gene and a gRNA expression vector aiming at a pig pAPN gene, the Cas9 expression vector is a plasmid complete sequence as shown in SEQ ID NO. 2. According to the invention, corresponding gRNA expression vectors are respectively designed aiming at different targets of INHA, CD163 and pAPN genes, and gRNA with relatively high editing efficiency and the expression vector thereof are obtained through screening. The modified Cas9 efficient expression vector is used for gene editing, and the editing efficiency is remarkably improved compared with that of an original vector.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a CRISPR / Cas9 system for gene editing of INHA, CD163 and pAPN and its application in constructing high-quality pig nuclear transplantation donor cells with high fecundity, resistance to PRRS and series of diarrheal diseases application. Background technique [0002] Pig is one of the earliest domesticated domestic animals in my country, and it has always been an important meat animal for human beings in the long river of history. The Chinese love to eat pork is related to the food culture for thousands of years. Since 2000, pork has accounted for more than 70% of my country's meat consumption, and it is the most important meat consumed in my country. At present, there are more than 40 million fertile sows in stock in my country. If each sow can produce one more piglet per litter on average, based on two litters per year, my country can reduce the breeding of 3-4 million...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/55C12N15/16C12N15/12C12N15/57C12N15/10C12N5/10
CPCC07K14/575C07K14/705C07K14/70596C12N5/0656C12N9/22C12N9/485C12N15/102C12N15/85C12N2510/00C12N2517/02C12N2800/107C12Y304/11002C12Q2521/327C12Q2525/161
Inventor牛冬汪滔马翔曾为俊刘璐王磊程锐赵泽英段星陶裴裴黄彩云
OwnerNANJING KGENE GENETIC ENG CO LTD