EGF mesenchymal stem cell exosome as well as preparation method and application thereof
A technology of mesenchymal stem cells and exosomes, applied in the field of EGF mesenchymal stem cell exosomes and its preparation, can solve the problems of insignificant biological activity, inability of EGF to play a specific targeting role, and low content, and achieve Good therapeutic effect, promoting proliferation and migration, accelerating healing effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] The construction of embodiment 1 lentiviral vector
[0040] 1. Design the lentiviral vector of the fusion protein EGF, innovatively design the corresponding sequence of the fusion protein according to the signal peptide sequence and transmembrane sequence of the mesenchymal stem cell surface marker CD44, each sequence is as follows: N-terminal signal peptide:
[0041] ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCG (SEQ ID NO. 1)
[0042] Target gene EGF:
[0043]ATGCTGCTCACTCTTATCATTCTGTTGCCAGTAGTTTCAAAATTTAGTTTTGTTAGTCTCTCAGCACCGCAGCACTGGAGCTGTCCTGAAGGTACTCTCGCAGGAAATGGGAATTCTACTTGTGTGGGTCCTGCACCCTTCTTAATTTTCTCCCATGGAAATAGTATCTTTAGGATTGACACAGAAGGAACCAATTATGAGCAATTGGTGGTGGATGCTGGTGTCTCAGTGATCATGGATTTTCATTATAATGAGAAAAGAATCTATTGGGTGGATTTAGAAAGACAACTTTTGCAAAGAGTTTTTCTGAATGGGTCAAGGCAAGAGAGAGTATGTAATATAGAGAAAAATGTTTCTGGAATGGCAATAAATTGGATAAATGAAGAAGTTATTTGGTCAAATCAACAGGAAGGAATCATTACAGTAACAGATATGAAAGGAAATAATTCCCACATTCTTTTAAGTGCTTTAAAATATCCTGCAAATGTAGCAGTTGATCCAGT...
Embodiment 2
[0057] Example 2 Characterization of Mesenchymal Stem Cells Infected with Viruses
[0058] 1. For the method of cell infection, take 10ug of the successfully constructed EGF plasmid and add it to the serum-free DMEM medium, then add 30μL of lipo3000 to it, mix well and let stand for 20min, add to the cell number of 4×10 6 HEK 293T cells, mix gently, place at 37°C, 5% CO 2 After 6 hours, the 5% FBS complete medium was replaced with 10 mL of 30% FBS complete medium. After 48 hours, the cell supernatant was collected and centrifuged at 4000 rpm for 15 minutes at room temperature. Take supernatant and add to cell number 4×10 6 Add polybrene with a final concentration of 8ug / ml to the mesenchymal stem cells, mix well, and place at 37°C, 5% CO 2 After 12 hours, replace with 10% FBS complete medium.
[0059] 2. Add puromycin at a final concentration of 2ug / ml to the infected cells after 24 hours to screen for resistant cells.
[0060] 3. Extract the RNA of wild-type mesenchymal c...
Embodiment 3
[0070] Example 3 Characterization of exosomes derived from mesenchymal stem cells after infection with lentivirus
[0071] 1. Extract wild-type mesenchymal cells (MSC), mesenchymal stem cells (MSC+EGF) co-incubated with EGF growth factor, and exocytosis of mesenchymal stem cells (EGF MSC) after lentivirus infection with integrated EGF sequence body. After the cells were cultured with 10% FBS complete medium to a density of 70%, they were replaced with 0.5% EVFree FBS medium, and after 48 hours, the cells were harvested on the culture medium. Centrifuge at 4°C, 500×g, 10min, and take the supernatant. Centrifuge at 4°C, 2000×g, 20min, and take the supernatant. Centrifuge at 4°C, 10000×g, 40min, and take the supernatant. Centrifuge at 4°C, 100000×g, 90min, and take the precipitate. After resuspending with PBS, centrifuge at 4°C, 100,000×g, 90min, take the precipitate and get the exosomes of mesenchymal stem cells, resuspend the exosomes with 100μl PBS and store in -80°C refri...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap