Microbial nutrient solution feed for animals and preparation method therefor
A technology of microorganisms and nutrient solution, which is applied in the field of microbial animal nutrient solution feed and its preparation, can solve the problems of poor use effect, high production cost, unstable quality, etc., and achieve the purpose of increasing the slaughter rate of pigs, reducing the feed-to-meat ratio, The effect of reducing the feed-to-meat ratio
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] This embodiment provides a microbial animal nutrition solution, including: probiotic bacteria solution, traditional Chinese medicine extract and trace element additives.
[0025] Further, the probiotic bacteria liquid includes: Bacillus subtilis, lactic acid bacteria, Saccharomyces cerevisiae, Bacillus cereus, Veillonella parvula), Lachnospira multiparus.
[0026] Further, the traditional Chinese medicine extracts include: Jiaohazha, Codonopsis pilosula, Laifuzi, dandelion, tangerine peel, yam, vine vine, and astragalus.
[0027] Further, the trace element additives include: iron hydroxymethionate, ferrous sulfate, zinc hydroxymethionate, zinc sulfate, yeast selenium, sodium selenite, manganese sulfate.
Embodiment 2
[0029] This embodiment provides a preparation method of microbial animal nutrient solution, comprising:
[0030] 1. Bacteria solution preparation
[0031] (1) Bacillus subtilis, lactic acid bacteria, Saccharomyces cerevisiae, and Bacillus cereus were purchased from Beina Biotech. Streak cultures were independently cultured on solid LB medium, and cultured at 35°C for 24h. The colony was picked and cultured with shaking in liquid LB medium for 24 hours, and stored at 4°C.
[0032] (2) Veillonella parvula and Lachnospira multiparus were taken from the vomitus of healthy people (the samples were obtained by physically stimulating the pharynx 2 hours after the meal) and cultured on solid LB medium by streaking, 35 Cultivate at ℃ for 24h. The colonies were picked and verified by PCR with the following primers:
[0033] Veillonella parvum F: CCGTACTGCATATCGGCTCG; Veillonella parvum R: GGAACTGTCACGTAACGTTCC;
[0034] Lachnospira multipair F: GAACTGCAATGGCGTACGGC; Lachnospira mul...
Embodiment 3
[0052] This embodiment provides a kind of microbial animal nutrient solution feed to improve the application of broiler production, including:
[0053] 1. Experimental method
[0054] One-day-old Cobb broiler chickens were selected and randomly divided into 2 groups, with 3 replicates in each group and 8 chickens in each replicate, for a total of 48 chickens. The control group was fed basic feed (common chicken feed of Tongwei Co., Ltd.) and purified water; the experimental group was the microbial animal nutrient solution group, which was fed with purified water containing bacterial liquid and fed with traditional Chinese medicine and trace element feed. The broilers were fed for 42 days, and the average daily gain, average daily feed intake and feed-to-meat ratio were calculated.
[0055] The purified water containing bacteria liquid includes: 100 mL of Bacillus subtilis liquid, 100 mL of lactic acid bacteria liquid, 100 mL of Saccharomyces cerevisiae liquid, and 100 mL of B...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap