Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Microbial nutrient solution feed for animals and preparation method therefor

A technology of microorganisms and nutrient solution, which is applied in the field of microbial animal nutrient solution feed and its preparation, can solve the problems of poor use effect, high production cost, unstable quality, etc., and achieve the purpose of increasing the slaughter rate of pigs, reducing the feed-to-meat ratio, The effect of reducing the feed-to-meat ratio

Pending Publication Date: 2021-07-23
YIZHITAI BIOTECH LONGYAN CO LTD
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Existing technical problems: There are more and more reports on microbial fermented animal feed at home and abroad, but due to its high production cost or unstable quality, the use effect is not good
Adding a single microbial nutrient solution cannot perform multiple functions, and the combination of multiple microorganisms needs to overcome whether the microbial living environment needs oxygen, fermentation temperature, fermentation pH, nutritional conditions necessary for fermentation, and preservation and transportation of microbial nutrient solutions.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microbial nutrient solution feed for animals and preparation method therefor
  • Microbial nutrient solution feed for animals and preparation method therefor
  • Microbial nutrient solution feed for animals and preparation method therefor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] This embodiment provides a microbial animal nutrition solution, including: probiotic bacteria solution, traditional Chinese medicine extract and trace element additives.

[0025] Further, the probiotic bacteria liquid includes: Bacillus subtilis, lactic acid bacteria, Saccharomyces cerevisiae, Bacillus cereus, Veillonella parvula), Lachnospira multiparus.

[0026] Further, the traditional Chinese medicine extracts include: Jiaohazha, Codonopsis pilosula, Laifuzi, dandelion, tangerine peel, yam, vine vine, and astragalus.

[0027] Further, the trace element additives include: iron hydroxymethionate, ferrous sulfate, zinc hydroxymethionate, zinc sulfate, yeast selenium, sodium selenite, manganese sulfate.

Embodiment 2

[0029] This embodiment provides a preparation method of microbial animal nutrient solution, comprising:

[0030] 1. Bacteria solution preparation

[0031] (1) Bacillus subtilis, lactic acid bacteria, Saccharomyces cerevisiae, and Bacillus cereus were purchased from Beina Biotech. Streak cultures were independently cultured on solid LB medium, and cultured at 35°C for 24h. The colony was picked and cultured with shaking in liquid LB medium for 24 hours, and stored at 4°C.

[0032] (2) Veillonella parvula and Lachnospira multiparus were taken from the vomitus of healthy people (the samples were obtained by physically stimulating the pharynx 2 hours after the meal) and cultured on solid LB medium by streaking, 35 Cultivate at ℃ for 24h. The colonies were picked and verified by PCR with the following primers:

[0033] Veillonella parvum F: CCGTACTGCATATCGGCTCG; Veillonella parvum R: GGAACTGTCACGTAACGTTCC;

[0034] Lachnospira multipair F: GAACTGCAATGGCGTACGGC; Lachnospira mul...

Embodiment 3

[0052] This embodiment provides a kind of microbial animal nutrient solution feed to improve the application of broiler production, including:

[0053] 1. Experimental method

[0054] One-day-old Cobb broiler chickens were selected and randomly divided into 2 groups, with 3 replicates in each group and 8 chickens in each replicate, for a total of 48 chickens. The control group was fed basic feed (common chicken feed of Tongwei Co., Ltd.) and purified water; the experimental group was the microbial animal nutrient solution group, which was fed with purified water containing bacterial liquid and fed with traditional Chinese medicine and trace element feed. The broilers were fed for 42 days, and the average daily gain, average daily feed intake and feed-to-meat ratio were calculated.

[0055] The purified water containing bacteria liquid includes: 100 mL of Bacillus subtilis liquid, 100 mL of lactic acid bacteria liquid, 100 mL of Saccharomyces cerevisiae liquid, and 100 mL of B...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a microbial nutrient solution feed for animals and a preparation method therefor. The microbial nutrient solution feed comprises a probiotics solution, a traditional Chinese medicine extract and a microelement additive. The probiotics solution comprises Veillonella parvula, Lachnospira multiparus and the like. The traditional Chinese medicine extract comprises parched hawthorn fruits, radix codonopsis pilosulae, radish seeds, dandelions, dried tangerine peel, rhizoma dioscoreae, Gelsemium elegans and radix astragali. The microelement additive comprises iron hydroxymethionine, ferrous sulfate, zinc hydroxymethionine, zinc sulfate, selenium yeast, sodium selenite and manganese sulfate. The microbial nutrient solution feed can be used for remarkably increasing the average daily gain and average daily feed intake of broiler chicken and remarkably lowering a feed / meat ratio; the average egg laying and single-egg average mass of laying hens are remarkably increased; and the thoracic gland index, bursa of fabricius index, spleen index and serum IgG content of the broiler chicken are remarkably increased. The microbial nutrient solution feed can be used for remarkably increasing the average daily gain and average daily feed intake of pigs and remarkably lowering the feed / meat ratio; and the dressing percentage and pure meat percentage of hogs are remarkably increased, and the cooling loss rate of carcasses is remarkably lowered.

Description

technical field [0001] The invention relates to the field of animal nutrient solution or functional feed, in particular to a microbial animal nutrient solution feed and a preparation method thereof. Background technique [0002] With the continuous improvement of people's living standards, people's requirements for the quality of meat products are getting higher and higher, and the green and pollution-free breeding industry has gradually become people's pursuit and expectation. my country's animal husbandry industry is uneven, and the digestion and utilization rate of feed by livestock and poultry is low, resulting in a potential waste of feed resources, and the colonization effect of microorganisms on the wall of the gastrointestinal tract is unstable. Extensive use of antibiotics and additives containing heavy metals has resulted in a decline in meat quality and even endangers the human body. The homeostasis of intestinal flora has become more and more popular in medicine...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A23K10/30A23K20/20A23K20/22A23K50/30A23K50/75A23K10/18
CPCA23K10/30A23K20/30A23K20/22A23K50/30A23K50/75A23K10/18Y02P60/87
Inventor 严建彬尹会方钟志龙严俊文林标声
Owner YIZHITAI BIOTECH LONGYAN CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com