Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of c-type lectin of Scylla pseudomae and its preparation method and application

The invention relates to a technology for lectin and lectin of Scylla simulans, which is applied in the field of C-type lectin of Scylla simulans and its preparation, and achieves the effects of less spots, less harm of antibiotics, and smaller molecular weight.

Active Publication Date: 2022-06-17
ZHEJIANG SCI-TECH UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report on the use of C-type lectin of the mud crab as an animal-derived immune enhancer to prevent and control the breeding diseases of the mud crab

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of c-type lectin of Scylla pseudomae and its preparation method and application
  • A kind of c-type lectin of Scylla pseudomae and its preparation method and application
  • A kind of c-type lectin of Scylla pseudomae and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] 1) Synthesize the gene shown below (SEQ ID NO. 2):

[0028] ACGGACGTCAACTCATCAAATACCGAGTGCCACAGCCCTTTCACGGAGGTTGCAGGTCGCTGCTTGCACATTGAAGTCGCCACCACTGGCTCGTGGCACAATATGCGAAAGCTCTGTCAGGACCTTGGGGGTGACCTGGTCAATCTTTCTGATCTGCAATTCTACGGTGACCTCATTTTGTACATTAAAAGTTTACATTTGCCATACGTTCATTTGTGGATCGGTGCCACGGACGAGGCGACGGAGGGCATCTGGATGTGGACAGATGGGACACCCGTCAGGATGGGCACTCCTTACTGGGCCAACTATAAGGACAACGTTCAAATGCCTGCTGGAGGAGAGAATCAAAACTGTGCTATGCTTGATATAAACATGCATTATTATTTCAATGATTATGGCTGTTCGTCACCAGATATAAGTCCGATTTGTGAG

[0029] 2) after the two ends of the gene shown in the above-mentioned SEQ ID No: 2 are added with enzyme cleavage sites Ncol / Xhol and His label, complete gene synthesis is carried out to obtain gene fragments: the complete gene synthesis of the present embodiment is a commissioned production. Engineering Bioengineering (Shanghai) Co., Ltd. (hereinafter referred to as Shenggong);

[0030] The vector pET32a and the gene fragment obtained from the above-mentioned steps were digested with...

Embodiment 2

[0035] The present embodiment provides a kind of preparation method of recombinant protein rSpctl-2:

[0036] The recombinant expression vector described in Example 1 was transformed into Escherichia coli BL21 (DE3) competent state by heat shock, the Escherichia coli strain containing the recombinant plasmid was selected, the single colony of Escherichia coli containing the recombinant plasmid after the antibiotic screening was selected, and the It was placed in LB liquid medium, and shaken at 37°C and 220rpm for 12h; sucked the bacterial liquid into LB medium, cultured at 37°C, 220rpm for 3.5h, and induced by adding 0.01mM IPTG, and the induction condition was 30°C , 4h, 220rpm, the recombinant protein expressed in the supernatant was prepared.

[0037] The induced supernatant was collected and detected as a single band of about 33 kD by SDS-PAGE.

[0038] The target protein was purified by nickel column affinity chromatography and detected as a single band of about 33kD by ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Scylla pseudomae C-type lectin Spctl-2, and the amino acid sequence of the Scylla pseudomae C-type lectin Spctl-2 is SEQ ID No: 1; The gene of Scylla C-type lectin Spctl-2, the nucleotide sequence of the antibacterial protein Spctl-2 gene is SEQ ID No: 2; The recombinant bacteriostatic protein rSpctl-2 of prime Spctl-2; the present invention also discloses the application of said recombinant bacteriostatic protein rSpctl-2 in the preparation of prevention and control of Vibrio infection; the present invention also discloses the recombinant bacteriostatic The application of the protein rSpctl-2 in the preparation and control of Micrococcus luteus; the invention also discloses the preparation method of the recombinant antibacterial protein rSpctl-2. The invention utilizes Escherichia coli to produce the recombinant protein, which has the advantage of secreted expression, is easy to industrialized production and provides more options for designing dosage forms of immune enhancers.

Description

technical field [0001] The invention relates to the field of biological control of aquatic product diseases, in particular to a C-type lectin of Scylla simulans and a preparation method and application thereof. Background technique [0002] The related diseases caused by bacterial infection lead to the low survival rate of Scylla simulans during the breeding process, thus causing huge losses to the related breeding industry. At present, antibiotics and synthetic antibiotics are mainly used to control the diseases of Scylla simulans to prevent and control the diseases caused by large-scale and intensive farming. Bacterial disease is a common aquatic disease in mud crab culture, mainly caused by Vibrio riviformis and Micrococcus luteus, which makes the survival rate of mud crabs low. Antibiotics are the main medicines for the prevention and treatment of the disease, but long-term use also leads to increased drug resistance and weakened efficacy. Therefore, it is of great sig...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/435C12N15/12C12N15/70C12N15/66C12N15/62A61K38/17A61P31/04
CPCC07K14/43509C12N15/70A61P31/04C07K2319/21A61K38/00
Inventor 夏艳婷黄萌萌董太伟曾博新郑小媛
Owner ZHEJIANG SCI-TECH UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com