Check patentability & draft patents in minutes with Patsnap Eureka AI!

Beta-galactosidase derived from bifidobacterium and application of beta-galactosidase

A technology of galactosidase and enzyme preparation, applied in the field of protease, can solve the problem of not being directly used in the food industry, etc., and achieve the effects of good enzyme activity and good pH tolerance

Pending Publication Date: 2021-12-10
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although studies on the production of β-galactosidase from microorganisms have been widespread, many of them cannot be directly used in the food industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Beta-galactosidase derived from bifidobacterium and application of beta-galactosidase
  • Beta-galactosidase derived from bifidobacterium and application of beta-galactosidase
  • Beta-galactosidase derived from bifidobacterium and application of beta-galactosidase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Embodiment 1: Obtain β-galactosidase (referred to as: B17_2 in the present invention)

[0023] 1. Construction of the recombinant expression vector of β-galactosidase B17_2:

[0024] According to the sequence characteristics of the gene and expression vector pET28a, the online software NEBcutter V2.0 and GenScrip were used to design primers:

[0025] PrimerF: AAAAAACATATGACTACTCGTAGAACGTTCAGG

[0026] PrimerR: GTGGTGCTCGAGTTAGCAGGACGTTTTTAGCG

[0027] Using the genome of the bifidobacterium B.longum020402 strain as a template, use High-Fidelity DNA Polymeras (New England Biolabs) obtains the DNA fragment of B17_2 by PCR amplification, and the nucleotide sequence of this fragment is shown in SEQ ID NO:2, and PCR system is as follows:

[0028] Table 1

[0029]

[0030] The PCR reaction conditions were pre-denaturation at 95°C for 5 min, melting at 95°C for 30 s, annealing at 72°C for 2 min, extension at 72°C for 10 min, and 32 cycles.

[0031] Plasmid pET28a and ...

Embodiment 2

[0034]Embodiment 2: Sequence analysis of recombinant β-galactosidase B17_2

[0035] After analysis, it was found that the primary structure of the recombinant β-galactosidase B17_2 of the present invention consists of 719 amino acids, and its specific amino acid sequence is shown in SEQ ID NO:1. Comparison of this with the sequence in NCBIblastp indicated that the sequence for the enzyme already existed in the database, but no associated characterization. A comparison of protein conserved domains revealed that the structure of the enzyme B17_2 consists of β-galactosidases belonging to the GH42 family (amino acid sequence 25-398) and β-galactosidases that form several polymeric domains (amino acid sequence 411-622 )composition( figure 2 ).

[0036] The primary sequence of B17_2 was compared with that of other β-galactosidases of the GH42 family ( image 3 ), the latter sequence belongs to the GH42 family of the carbohydrate database and belongs to Bifidobacteria. The compa...

Embodiment 3

[0037] Embodiment 3: Recombinant β-galactosidase B17_2 hydrolysis activity

[0038] The amount of enzyme that hydrolyzes ONPG (o-nitrophenyl β-D-galactopyranoside, as the substrate of β-galactosidase) within 1 min to release 1 μmol ONP (o-nitrophenol) is taken as an activity unit 1U. Group β-galactosidase B17_2 and commercial β-galactosidase (Diamond, China), with enzyme concentrations of 0.87 μg / mL and 0.044 mg / mL, were added to the PBS buffer solution reaction system containing 2 mmol / L ONPG, and The reaction was performed at different temperatures to determine the effect of temperature on enzyme activity. Recombinant β-galactosidase B17_2 and commercial β-galactosidase were added to the buffer solution reaction system containing 2mmol / L oNPG with different pH values, reacted at the optimum temperature, and the effect of pH value on enzyme activity was determined. Under optimum pH conditions, recombinant β-galactosidase B17_2 and commercial β-galactosidase were incubated at...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides beta-galactosidase. The amino acid sequence of the beta-galactosidase is as shown in SEQ ID NO: 1. The gene of the amino acid sequence as shown in SEQ ID NO: 1 is edited, and the nucleotide sequence of the gene is as shown in SEQ ID NO: 2. The optimum temperature of the beta-galactosidase is 45 DEG C, the optimum pH value is 5.5, and the beta-galactosidase has good enzyme activity and good pH (4-9) tolerance at the temperature of 35-50 DEG C. When oNPG is hydrolyzed, the specific activity is 3826.28 + / -137.56 U / mg, the Km is 1.75 + / -0.2 mmol / L, the kcat is 5127 + / -183 s <-1 >, and the kcat / Km is 2928 mM * s <-1 >. The specific activity of the beta-galactosidase B17_2 for degrading lactose in cow milk is 2.34 + / -0.19 U / mg, and the specific activity of the beta-galactosidase B17_2 in acidic whey is 4.84 + / -0.78 U / mg.

Description

technical field [0001] The invention belongs to the technical field of protease, and in particular relates to a beta-galactosidase derived from bifidobacteria and an application thereof. Background technique [0002] β-galactosidase is involved in catalyzing the hydrolysis of terminal β-1,4-D-galactose residues in β-D-galactosides, such as the hydrolysis of lactose. At the same time, it can also participate in the transglycosylation reaction to generate galacto-oligosaccharides and fructo-oligosaccharides. In the carbohydrate-active enzyme database, they are classified into five distinct families (GH1, GH2, GH35, GH42 and GH59) according to their sequence, activity and structure. β-galactosidase is widely used in the food industry to improve the flavor of dairy and bakery products. It can also convert whey into useful products such as ethanol and sweet syrup, or solve whey processing by converting whey into lactic acid. Furthermore, its ability to produce colored products...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/38C12N15/56C12N15/70C12N1/21C12P19/00C12P19/14C12R1/19
CPCC12N9/2471C12Y302/01023C12N15/70C12P19/00C12P19/14
Inventor 谢新强杨双红杜明珠张菊梅吴清平蔡淑珍蒋同梁婷婷李滢柏建玲陈玲刘振杰
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com