Application of single nucleotide polymorphism of goat MMP9 gene in early selection of lactation character

A technology of lactation traits and polymorphism, applied in the field of molecular genetics, can solve problems such as unseen research reports, and achieve the effect of increasing the speed of breeding

Active Publication Date: 2022-01-11
SHANDONG AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, there is no relevant research report on the correlation analysis between the single nucleotide polymorphism of MMP9 gene and the lactation traits of dairy goats at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of single nucleotide polymorphism of goat MMP9 gene in early selection of lactation character
  • Application of single nucleotide polymorphism of goat MMP9 gene in early selection of lactation character
  • Application of single nucleotide polymorphism of goat MMP9 gene in early selection of lactation character

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Example 1: Cloning, sequencing, sequence alignment and mutation site analysis of the 5' regulatory region sequence of dairy goat MMP9 gene

[0067] 1. Test material

[0068] 1.1 Experimental drugs and reagents: Taq DNA polymerase; Xho I and KpnI restriction enzymes, T4 DNA ligase, DNA Maker 500, DNA Maker 2000, DNA Maker 5000, Treasure Bioengineering (Beijing) Co., Ltd.; Escherichia coli (Escherichia coli) DH5α, Beijing Quanshijin Biotechnology Co., Ltd.; Lipofectamine TM 2000, Invitrogen Corporation; Reporter Assay System, pGL3-Basic and pRL-TK, Promega; Opti-MEM, DMEM medium, fetal bovine serum, Gibco; 293T cell line purchased from the Chinese Academy of Sciences Cell Bank; isoamyl alcohol, absolute ethanol, sodium acetate , ethidium bromide (EB), agarose, etc. were purchased from Tai'an Keshang Biological Co., Ltd.; blood genomic DNA extraction kit, endotoxin-free plasmid large-scale extraction kit, plasmid small-scale extraction kit, Tiangen Biochemical Technolo...

Embodiment 2

[0089] Example 2: Association analysis of polymorphic sites in the 5' regulatory region of dairy goat MMP9 gene and lactation traits

[0090] 1. Genotype detection of the 5' regulatory region of the MMP9 gene

[0091] The blood DNA of all dairy goats in Example 1 was subjected to KASP (competitive allele-specific PCR) SNP genotyping, and statistical analysis was performed on individuals of each genotype. The information of the KASP typing primer pair used is as follows:

[0092] The primer sequences used for genotyping detection of the mutation site -2003A>G are:

[0093] MMP9-1 Allele FAM: AAATTGACCTTGGAACTGGAGATTAAC; (SEQ ID NO. 4)

[0094] Allele HEX: CAAATTGACCTTGGAACTGGAGATTAAT; (SEQ ID NO. 5)

[0095] Common: CTGACCAGCATCACCTGGATTGTTT. (SEQ ID NO.6)

[0096] The primer sequences used for genotyping detection of the mutation site -1863A>G are:

[0097] MMP9-2 Allele FAM: AGTACCTATAAGACAGCTCACAGG; (SEQ ID NO. 7)

[0098] Allele HEX: CAGTACCTATAAGACAGCTCACAGA; (SEQ ID ...

Embodiment 3

[0133] Example 3: Effects of polymorphic sites in the 5' regulatory region of dairy goat MMP9 gene on gene expression

[0134] 1. Experimental materials

[0135] Randomly take 3-5 healthy Laoshan milk goats from Qingdao Aote sheep farm

[0136] 2. Experimental method

[0137] 2.1 Construction of polymorphic site mutant luciferase expression vector in the 5' regulatory region of MMP9 gene

[0138] 2.1.1 In the Laoshan dairy goat population, select pure individuals with AA in the 5' regulatory region c.-2003A>G and c.-1863A>G of the MMP9 gene, and construct a dual-luciferase vector, using it as a template The sequences of MUT1-MMP9 and MUT2-MMP9 were obtained, and a dual-luciferase point mutation vector was constructed. The sequences of the point mutation amplification primers are shown in SEQ ID NO.10-SEQ ID NO.13, respectively, see Table 4 for details.

[0139] Table 4: Construction of luciferase point mutation vector amplification primer sequences

[0140]

[0141] 2.1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an application of single nucleotide polymorphism of a goat MMP9 gene in early selection of lactation traits. Two new SNP loci (c.-2003A > G and c.-1863A > G) located in a 5'regulation region of the MMP9 gene of the milk goat are identified for the first time, gene frequency and genotype frequency analysis and correlation analysis with milk goat lactation traits are carried out, and the result shows that the SNP loci can be used as marker loci of the milk goat lactation traits, so that the marker loci can be used as marker loci of the milk goat lactation traits. The method can be used for accelerating establishment of goat populations with excellent lactation characters, so that the breeding speed of improved varieties is increased.

Description

technical field [0001] The invention relates to the technical field of molecular genetics, in particular to the application of goat MMP9 gene single nucleotide polymorphism in early selection of lactation traits. Background technique [0002] Dairy goat is a kind of goat for dairy use. It is an excellent breed that has been highly selected and bred. It has stable milk production performance and high milk production. In addition, goat milk has comprehensive nutrition, excellent milk quality and high nutritional value. It is suitable for drinking and an important raw material for the modern dairy industry. The lactation traits of dairy goats include milk production and milk components, where milk components include lactose rate, milk protein rate, milk fat rate, true protein rate, total solid content and non-fat solid content. [0003] Laoshan dairy goat is one of the fine breeds for milk use. The estrus period is mostly in autumn, and the lambing rate is about 180%. The mil...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/6858C12N15/11
CPCC12Q1/6888C12Q1/6858C12Q2600/124C12Q2600/156C12Q2600/158C12Q2531/113C12Q2535/122Y02P60/87
Inventor 纪志宾李庆晁天乐王建民玄荣李培培程明
Owner SHANDONG AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap