Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Microfluidic detection system for identifying nontuberculous mycobacterium strains

A mycobacterium and non-tuberculosis technology, applied in the field of microbial detection, can solve problems such as unfavorable clinical and timely diagnosis, and achieve good clinical application prospects, high sensitivity, and good specificity

Pending Publication Date: 2022-05-10
GUANGZHOU DEAOU MEDICAL TECH CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, NTM disease mainly relies on laboratory pathogenic detection for diagnosis. The p-nitrobenzoic acid selective medium method and MPB64 antigen detection method can only preliminarily identify MTBC and NTM; For clinical specimens, it can only be used to cultivate positive strains, which is not conducive to timely clinical diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microfluidic detection system for identifying nontuberculous mycobacterium strains
  • Microfluidic detection system for identifying nontuberculous mycobacterium strains
  • Microfluidic detection system for identifying nontuberculous mycobacterium strains

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] The present embodiment provides specific detection of Mycobacterium intracellulare, Mycobacterium avium, Mycobacterium chelonae, Mycobacterium sulja, Mycobacterium simiensis, Mycobacterium marinum, Mycobacterium terrae, Gordon's species For the primer sets of Mycobacterium, Mycobacterium kansasii, and Mycobacterium fortuitum, a sequencing company is entrusted to synthesize the primers. The sequences of each primer set are:

[0054] (1) Mycobacterium intracellulare-specific detection primer set includes:

[0055] Forward outer primer F3: GGATGCGGGTCAAGTACG (SEQ ID NO: 1);

[0056] Reverse outer primer B3: CGTTATGCAGCGTGTTGAAG (SEQ ID NO: 2);

[0057] Forward internal primer FIP:

[0058] GTTTGAAGGCCACCTTGCGGTCTCCACCGAAGAATTCACCA (SEQ ID NO: 3);

[0059] Reverse inner primer BIP:

[0060] GCAGCTATCGCGACGTCGACCTCTCTCCTGGATACCTTCCT (SEQ ID NO: 4);

[0061] Forward loop primer LF: GCAGCGAGTTGATGAAGTCGT (SEQ ID NO: 5);

[0062] Reverse loop primer LB: GTGCTGCTCGTCGATGAC...

Embodiment 2

[0145] refer to figure 1 , this embodiment provides a microfluidic chip.

[0146] The microfluidic chip includes a chip body, and the chip body is provided with a sampling hole 1, a main channel 2, a microfluidic channel 6 and a reaction hole; the reaction hole includes a positive quality control hole 4, a positive control hole 5 and at least A detection hole 3; the sample loading hole 1 communicates with the main channel 2; each reaction well communicates with the main channel 2 through the micro flow channel 6; each of the detection holes 3 contains a specific non-tuberculous mycobacterium Sex detection primer set.

[0147] As a preferred solution, a buffer hole 7 is also provided between the reaction hole and the main channel 2 . By setting the buffer hole, so that the sample solution to be tested is filled with the buffer hole 7 first during the sampling process, and then enters the detection hole 3 or the positive quality control hole 4, and the positive control hole 5,...

Embodiment 3

[0153] This embodiment provides a method for using the microfluidic chip provided by the present invention to perform specific detection of non-tuberculous mycobacteria, including:

[0154] (1) Genome extraction kits were used to extract Mycobacterium intracellulare, Mycobacterium avium, Mycobacterium chelonis, Mycobacterium sulja, Mycobacterium ape, Mycobacterium marinum, Mycobacterium terrae, and Gordon Genomic DNA of Mycobacterium, Mycobacterium kansasii, and Mycobacterium fortuitum was used as the template DNA to be tested.

[0155] (2) Prepare the reaction solution to be tested, including: 1 μL Tris (20mM), 1 μL KCL (10mM), 1 μL MgSO 4 (5mM), 1 μL NaH 2 PO 4 (10mM), 1μL Tween (0.5mM), 3.5μL dNTPs (1.5mM), 4μL betaine (1M), 1μL Bst enzyme, 0.5μL SYTO-9, 2μL test template DNA, 8μL sterilized water.

[0156] (3) Add the reaction solution to be tested prepared in step (2) to the sampling hole 1 on the microfluidic chip, so that the sample solution to be tested is distribut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a microfluidic detection system for non-tuberculosis mycobacterium strain identification, the detection system uses a microfluidic chip for detection, the microfluidic chip comprises a chip body, the chip body is provided with a sample adding hole, a main flow channel, a micro flow channel and a reaction hole; the reaction holes comprise a positive quality control hole, a positive control hole and at least one detection hole; the sample adding hole is communicated with the main runner; each reaction hole is communicated with the main flow channel through the micro flow channel; and each detection hole contains a specific detection primer group of the nontuberculous mycobacterium. Through the microfluidic monitoring system, more than ten nontuberculous mycobacteria strains can be simultaneously subjected to specific detection under isothermal conditions, and the microfluidic monitoring system has the advantages of good specificity, high sensitivity, simplicity in operation, rapidness in detection and the like, and has a good clinical application prospect.

Description

technical field [0001] The invention relates to the technical field of microbial detection, in particular to a microfluidic detection system for identification of non-tuberculous mycobacteria. Background technique [0002] Non-tuberculous mycobacteria (NTM) refers to mycobacteria other than Mycobacterium tuberculosis complex and Mycobacterium leprae, which widely exist in various natural environments and are conditionally pathogenic bacteria for humans. , has become one of the important public health problems threatening human health. Nontuberculous mycobacteria can easily cause lung and skin infections, and lung diseases are the most common. Since the mid-1990s, especially with the prevalence of AIDS, organ transplantation, and the use of immunosuppressants, the prevalence of non-tuberculous mycobacterium infection has been increasing. NTM disease and tuberculosis are very similar in clinical manifestations and imaging manifestations, and clinicians are prone to misdiagno...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12M1/34C12M1/00B01L3/00C12Q1/689C12Q1/6844C12N15/11C12R1/32C12R1/325C12R1/33
CPCB01L3/5027C12Q1/689C12Q1/6844C12Q2531/119C12Q2563/107C12Q2565/629
Inventor 陈皇佑刘教
Owner GUANGZHOU DEAOU MEDICAL TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com