Unlock instant, AI-driven research and patent intelligence for your innovation.

Compound fermentation inoculant for fermenting mycotoxin polluted feed and application of compound fermentation inoculant

A technology for compound fermentation inoculants and compound inoculants, applied in the field of microbiology, can solve the problems of lack of compound inoculants that can remove multiple toxins at the same time, and achieve excellent effects.

Active Publication Date: 2022-05-13
QINGDAO AGRI UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most of the prior art is directed at a single toxin and lacks a compound bacterial agent that can remove multiple toxins at the same time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compound fermentation inoculant for fermenting mycotoxin polluted feed and application of compound fermentation inoculant
  • Compound fermentation inoculant for fermenting mycotoxin polluted feed and application of compound fermentation inoculant
  • Compound fermentation inoculant for fermenting mycotoxin polluted feed and application of compound fermentation inoculant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Isolation and Screening of Lysinibacillus HQ08

[0023] (1) Configure 1L of screening medium: 5g of ammonium sulfate, 2.5g of potassium dihydrogen sulfate, 1g of magnesium sulfate, 0.5g of disodium hydrogen phosphate, 15-20g of agar powder, adjust the pH to 7, sterilize at 120°C for 30min, and cool to After room temperature, add aflatoxin B1 standard substance to adjust the final concentration to 1 μg / ml;

[0024] (2) Weigh 1g of soil, dissolve it in 100ml of sterile distilled water, let it stand at room temperature for 5min, take the supernatant and dilute it with sterilized distilled water into different concentration gradients, take 1ml of soil and spread it on the screening medium, and incubate at 37°C;

[0025] (3) Pick single colonies with different shapes and use LB liquid medium for expansion culture, dilute with sterilized distilled water, take 1ml and spread it on the screening medium, and culture at 37°C;

[0026] (4) Pick a single colony, use the streak met...

Embodiment 2

[0029] Isolation and screening of Sinorhizobium meliloti strain CM77

[0030] (1) Primary screening:

[0031] 1) Prepare improved basal salt medium (1L): 0.5 g ammonium nitrate, 0.5 g potassium dihydrogen phosphate, 1.5 g dipotassium hydrogen phosphate, 1 g sodium chloride, 0.02 g magnesium sulfate, 1000 mL distilled water, pH=7.4 ; Add 15-20 g agar, mix and sterilize;

[0032] 2) Prepare zearalenone at a final concentration of 1 µg / mL, add it to the culture medium, mix well, and pour it onto the plate;

[0033] 3) Weigh the soil in the natural environment, dissolve it in sterile distilled water or saline, mix it and let it stand, take the supernatant, semi-turbidity and turbidity respectively, and put them into the above-mentioned plate;

[0034] 4) Put it in a constant temperature incubator at 37 ℃ for cultivation, and pick a single colony when the colonies on the plate reach 70-80%;

[0035] 5) Carry out expansion propagation at 37°C and 170 rpm.

[0036] (2) Re-screeni...

Embodiment 3

[0040] Identification of strains

[0041] (1) Extract the total DNA of the bacterial liquid, use the 27F and 1492R primers for PCR amplification as the bacterial liquid PCR template;

[0042] (2) The PCR amplification reaction system (10 μl) is as follows:

[0043] cDNA 1μl, 10×Buffer 1μl, 2.5 mM dNTP 0.8μl, 10μM forward and reverse primers 0.5μl each, rTaq enzyme 0.05μl, 2H 2 O 6.15 μl;

[0044] name Sequence (5'-3') 27F16s AGAGTTTGATCCTGGCTCAG 1492R16s GGTTACCTTGTTACGACTT M13(-47) CGCCAGGGTTTTTCCCAGTCACGAC M13(-48) AGCGGATAACAATTTCACACAGGA

[0045] (4) The PCR reaction conditions are:

[0046] 94°C 5min; 94°C 30s, 51°C 30s, 72°C 1min, 30 cycles, 72°C 10min;

[0047] (5) After the entire reaction is over, the reaction product is detected by 1.0% agarose gel electrophoresis, the target band is cut back under the gel imaging system, and the DNA is recovered and purified according to the instructions of Shanghai Sangong SanPrep colum...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a compound fermentation inoculant for fermenting polluted feed and application thereof, and belongs to the technical field of microorganisms. The compound fermentation bacterial agent provided by the invention is prepared from lysine bacillus HQ08 and sinorhizobium meliloti, the preservation number of the lysine bacillus HQ08 is CGMCC (China General Microbiological Culture Collection Center) No.24221, and the preservation number of the sinorhizobium meliloti CM77 is CGMCC No.24222. The compound fermentation bacterial agent provided by the invention has the advantages that the compound fermentation bacterial agent can be used for preparing a compound fermentation bacterial agent; the compound fermentation inoculant provided by the invention can effectively reduce zearalenone toxin and aflatoxin B1 in the feed at the same time, and has excellent effects.

Description

technical field [0001] The invention belongs to the technical field of microbiology, and in particular relates to a compound fermentation bacterial agent for fermenting polluted feed and its application. Background technique [0002] Crops such as corn, wheat, barley and peanuts and their by-products are often contaminated with mycotoxins during harvesting, drying and storage. From 2015 to 2020, the detection rates of aflatoxins, zearalenone, deoxynivalenol, and fumonisins in agricultural and sideline products continued to increase. Since 2016, the detection rate of aflatoxin B1 in corn by-products has risen sharply, and has been at a relatively high level of pollution for three consecutive years. Moreover, aflatoxin B1 exists in bran products in Shandong, Jiangsu, Yunnan, Anhui and other places and zearalenone heavy pollution phenomenon. At the same time, in recent years, the pollution situation of zearalenone in my country has been very serious, and the exceeding rate of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A23L5/20A23K10/12C12R1/07C12R1/41
CPCC12N1/20A23L5/28A23K10/12C12R2001/07C12R2001/41Y02P60/87
Inventor 朱伟冯政夫刘冬美
Owner QINGDAO AGRI UNIV