Compound fermentation inoculant for fermenting mycotoxin polluted feed and application of compound fermentation inoculant
A technology for compound fermentation inoculants and compound inoculants, applied in the field of microbiology, can solve the problems of lack of compound inoculants that can remove multiple toxins at the same time, and achieve excellent effects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Isolation and Screening of Lysinibacillus HQ08
[0023] (1) Configure 1L of screening medium: 5g of ammonium sulfate, 2.5g of potassium dihydrogen sulfate, 1g of magnesium sulfate, 0.5g of disodium hydrogen phosphate, 15-20g of agar powder, adjust the pH to 7, sterilize at 120°C for 30min, and cool to After room temperature, add aflatoxin B1 standard substance to adjust the final concentration to 1 μg / ml;
[0024] (2) Weigh 1g of soil, dissolve it in 100ml of sterile distilled water, let it stand at room temperature for 5min, take the supernatant and dilute it with sterilized distilled water into different concentration gradients, take 1ml of soil and spread it on the screening medium, and incubate at 37°C;
[0025] (3) Pick single colonies with different shapes and use LB liquid medium for expansion culture, dilute with sterilized distilled water, take 1ml and spread it on the screening medium, and culture at 37°C;
[0026] (4) Pick a single colony, use the streak met...
Embodiment 2
[0029] Isolation and screening of Sinorhizobium meliloti strain CM77
[0030] (1) Primary screening:
[0031] 1) Prepare improved basal salt medium (1L): 0.5 g ammonium nitrate, 0.5 g potassium dihydrogen phosphate, 1.5 g dipotassium hydrogen phosphate, 1 g sodium chloride, 0.02 g magnesium sulfate, 1000 mL distilled water, pH=7.4 ; Add 15-20 g agar, mix and sterilize;
[0032] 2) Prepare zearalenone at a final concentration of 1 µg / mL, add it to the culture medium, mix well, and pour it onto the plate;
[0033] 3) Weigh the soil in the natural environment, dissolve it in sterile distilled water or saline, mix it and let it stand, take the supernatant, semi-turbidity and turbidity respectively, and put them into the above-mentioned plate;
[0034] 4) Put it in a constant temperature incubator at 37 ℃ for cultivation, and pick a single colony when the colonies on the plate reach 70-80%;
[0035] 5) Carry out expansion propagation at 37°C and 170 rpm.
[0036] (2) Re-screeni...
Embodiment 3
[0040] Identification of strains
[0041] (1) Extract the total DNA of the bacterial liquid, use the 27F and 1492R primers for PCR amplification as the bacterial liquid PCR template;
[0042] (2) The PCR amplification reaction system (10 μl) is as follows:
[0043] cDNA 1μl, 10×Buffer 1μl, 2.5 mM dNTP 0.8μl, 10μM forward and reverse primers 0.5μl each, rTaq enzyme 0.05μl, 2H 2 O 6.15 μl;
[0044] name Sequence (5'-3') 27F16s AGAGTTTGATCCTGGCTCAG 1492R16s GGTTACCTTGTTACGACTT M13(-47) CGCCAGGGTTTTTCCCAGTCACGAC M13(-48) AGCGGATAACAATTTCACACAGGA
[0045] (4) The PCR reaction conditions are:
[0046] 94°C 5min; 94°C 30s, 51°C 30s, 72°C 1min, 30 cycles, 72°C 10min;
[0047] (5) After the entire reaction is over, the reaction product is detected by 1.0% agarose gel electrophoresis, the target band is cut back under the gel imaging system, and the DNA is recovered and purified according to the instructions of Shanghai Sangong SanPrep colum...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


