Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene for coding recombinant NlpC/P60 endopeptidase protein and application thereof

A technology of P60 and endopeptidase, applied to the gene encoding recombinant NlpC/P60 endopeptidase protein and its application field, can solve the problems of limited success rate and achieve the effect of low cost, high purity and simple operation

Pending Publication Date: 2022-05-17
SOUTH CHINA AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The prevention and control of colibacillosis is a major problem in the farming industry, because E. coli is part of the normal intestinal flora of poultry, and the success rate of management strategy-based methods is limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene for coding recombinant NlpC/P60 endopeptidase protein and application thereof
  • Gene for coding recombinant NlpC/P60 endopeptidase protein and application thereof
  • Gene for coding recombinant NlpC/P60 endopeptidase protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Construction of NlpC / P60 endopeptidase protein particle NlpC / P60 in pET-28a(+)

[0053] (1) According to the amino acid sequence of NlpC / P60 endopeptidase protein, optimize its nucleotide sequence, obtain the nucleotide sequence of the optimized NlpC / P60 endopeptidase protein, wherein, NlpC / P60 endopeptidase protein The original nucleotide sequence and the nucleotide sequence of the optimized NlpC / P60 endopeptidase protein are as follows:

[0054] Original nucleotide sequence of NlpC / P60 endopeptidase protein:

[0055] ATGTGGTTCAAGGGGGTACTCACGATCTCTGCCCTACTACTAATCCTGTCAGGGTGTTCAACCAAATCCATAGACCCATACGGCGAACAGAATTCCTATGACAACATTGGCTCCAAGTACCAAAAGAATGATACCACGAGTGGATATAACTTCAATTACAACCAAGCTGCCGACGAGTTTTATAACATAAATCTCTCCAAATATCTTAACAAAAAGTTAGGTAATGACTGCAGTGGATTCGTGTCTTTAGTTAATGAGGATTCCAAATCGTTATATTTCGACGAAAATATTGTCAATAATTTCTACGACAAAAACGGCCGTAAGAGCCAAGCCATCTTTAACCTCTACAAGTCACAGAACAAGATCTCATATACCGATCCTAAACCTGGTGATCTGGTGTTCTTCAACAACACGACATCTCGCACAAACAAGTCTAAGAATAAAGCCAT...

Embodiment 2

[0062] Induced expression of embodiment 2 recombinant NlpC / P60 endopeptidase protein

[0063](1) The recombinant expression plasmid NlpC / P60in pET-28a(+) (using NlpC / P60'in ​​pET-28a(+) as a control) preserved in Example 1 for expressing recombinant NlpC / P60 endopeptidase protein was routinely Methods Transformed into the recipient Escherichia coli BL21(DE3), the specific method was as follows: 25 μg of recombinant expression plasmid and 100 μL of BL21(DE3) competent cells were mixed, placed on ice for 30 minutes, heat-shocked in a water bath at 42°C for 90 seconds; then added 1ml of LB Broth culture medium, at 37 ℃, resuscitated and activated on a shaking table at 200rpm for 1h, centrifuged at 3000rpm for 1min, discarded 90% of the supernatant, and coated the bacterial solution with LB containing kanamycin (containing 30mg / L of kanamycin (Kan)) plate for resuscitation and activation, cultured at 37°C for 16 hours; pick a single colony and use T7 primers for colony PCR confirm...

Embodiment 3

[0074] Embodiment 3 Purification, dialysis and sterilization of recombinant NlpC / P60 endopeptidase protein

[0075] (1) Equilibrium column: first use ddH 2 O removes ethanol from the nickel column, ddH 2 O is greater than 5 column volumes, then use Lysisbuffer for column equilibration.

[0076] (2) Sample loading: Slowly inject the supernatant obtained in step (4) of Example 2 into the nickel column.

[0077] (3) Elution: Use 500 μl Elution buffer to elute the column, use a 1.5mL ep tube to collect the liquid dripping from the nickel column, and elute 4 times to obtain 4 tubes of purified protein.

[0078] (4) Dialysis: Take the 2nd and 3rd tube proteins in step (3), put them into a 3000Da protein dialysis bag, add 1L PBS (pH=7.4), put them in a 4°C refrigerator, and dialyze the protein samples until the next day.

[0079] (5) Sterilization: Take the dialyzed protein in a 1.5ml ep tube, add glycerol with a volume fraction of 20%, centrifuge at 12000g for 5min, take the supe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and particularly relates to a gene for coding recombinant NlpC / P60 endopeptidase protein and application of the gene. Through a genetic engineering method, the NlpC / P60 endopeptidase gene is subjected to codon optimization, then a recombinant expression vector and a prokaryotic expression system are constructed, recombinant fusion protein expression is induced, the escherichia coli-resistant recombinant NlpC / P60 endopeptidase protein is obtained, the protein can achieve the killing effect of two orders of magnitude on escherichia coli BL21 (DE3), and the escherichia coli-resistant recombinant NlpC / P60 endopeptidase protein has a good application prospect. A novel method for resisting gram-negative bacteria such as escherichia coli is provided, the problem of drug resistance of gram-negative bacteria such as escherichia coli can be solved, and the method has great significance in prevention and treatment of poultry colibacillosis and the like.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a gene encoding recombinant NlpC / P60 endopeptidase protein and application thereof. Background technique [0002] Escherichia coli (E. coli) are a diverse group of bacteria that are a normal part of the poultry microecology. E. coli is present throughout the gut, upper respiratory tract, and on the skin and feathers of healthy birds. Although most E. coli strains are harmless to poultry health, some strains are capable of causing disease outside the intestinal tract. Those E. coli that can cause disease in poultry, or when the host's defense system is compromised, are called avian pathogenic E. coli (APEC). APEC is a major cause of morbidity and mortality in the global poultry industry. Disease syndromes associated with APEC include hemorrhagic sepsis, air sacculitis, swollen head syndrome, plethora, enteritis, E. coli cellulitis, peritonitis, salpingitis, testicular Os...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/57C12N9/52C12N15/70C12N1/21A61K38/48A61P31/04C12R1/19
CPCC12N9/52C12N15/70A61P31/04C12N2800/22A61K38/00Y02A50/30
Inventor 刘珮琪董心迎谢倩梅李伟业黄秀琴曹雪薇江金飞代绘琳罗开健冯赛祥
Owner SOUTH CHINA AGRI UNIV