Cotton Na+/H+ reverse transport protein gene and its cloning method and application

An antiporter, gene technology, applied in the field of molecular biology and biology, can solve problems such as less obvious effect

Inactive Publication Date: 2005-02-23
SHANDONG AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Early salt-tolerant genetic engineering mainly focused on scavenging free radicals and increasing osmotic adjustment substances. The salt-tolerant ability of transgenic plants has improved, but the effect is not obvious

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cotton Na+/H+ reverse transport protein gene and its cloning method and application
  • Cotton Na+/H+ reverse transport protein gene and its cloning method and application
  • Cotton Na+/H+ reverse transport protein gene and its cloning method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0103] Embodiment 1: Cotton Na + / H + Cloning method of antiporter gene

[0104] 1. Extraction of total RNA: Total RNA was extracted using RNAeasy mini kit (product of Promoga).

[0105] 2. Synthesis of the first strand of cDNA: take 2 micrograms of total RNA, add 4 μl of 5× reaction buffer, 2 μl of 10 mM deoxyribonucleic acid (dNTP), 0.5 μl of ribonuclease inhibitor (40-200u / μl), primer T26 (10 pmol / μl) 1 μl, reverse transcriptase (10u / μl) 2 μl, react at 42°C for 60 minutes, and stop the reaction at 85°C for 10 minutes.

[0106] 3. PCR reaction: polymerase chain reaction (PCR) reagents and conditions are:

[0107] First mix the following reagents together:

[0108] 10×Reaction Buffer 5μl

[0109] 10mM deoxynucleotide mixture (dNTP) 1μl

[0110] Forward primer (10μM) 2μl

[0111] Reverse primer (10(M) 2μl

[0112] Template cDNA 1μl

[0113] Taq DNA polymerase 0.5μl

[0114] Total volume 50μl

[0115] The PCR reaction conditions are: 94°C for 5 minutes, and then ente...

Embodiment 2

[0121] Embodiment 2: Cotton Na + / H + Antiporter gene GhNHX1, the following sequence:

[0122] (1) Information on SEQ ID NO 1

[0123] (a) Sequential features

[0124] * Length: 2485 bp

[0125] *Type: nucleic acid

[0126] * Chain type: double chain

[0127] *Topology: Linear

[0128] (b) Molecular type: cDNA

[0129] (c) Assumption: No

[0130] (d) Antisense: No

[0131] (e) Original source: Cotton

[0132] (f) Sequence description: SEQ ID NO.1

[0133] ACGCGGGGCAACACAGTCTTGATTTTGATCGTTTTTCGCTCCCATCGAAAGCGAAGATTT 60

[0134] TAAGCTGAAAAAAGAAGAGAGGAAAATTGTGGCAATTTGTTGGTGAGAAAGTCGAAGATT 120

[0135] CACGTGGGTAAGTCCATAAACAGTGAAACATTGGATTTTCTTTTTTGTTTTTTGTTTTCT 180

[0136] CAAGCTCTCTCTTCGAATTTACTCGTCTCTTTGAAACTGTCCGTTTTTTTTTTGGTTCAAT 240

[0137] AAAATCGCAAATTATTTGCTAATTTAGAGAAGAAAATTGAACGGAGCTGAAACAAGGATG 300

[0138] ATTTGTTGCTGCATGATGTTGATTCTCCAAAACGATTCGAGTGCTTAAGGATTTTAAGAT 360

[0139] TAGAAAGTTCTTGAAATGGACAGTTCAGAGGCATAAAAAATTTTCGAAGATTTACATTGTT 420

[0...

Embodiment 3

[0190] Embodiment 3: Construction of expression vector

[0191] 1. According to the isolated cotton Na + / H + Nucleotide sequence of antiporter gene GhNHX1, designed primers:

[0192] Forward primer: 5′-ATGGTGGCTCCGCAGTTAGCT-3′

[0193] Reverse primer: 5'-ACCTCATTGCCATTGAGGCAG-3'

[0194] Polymerase chain reaction was carried out using the cDNA reverse transcribed from the total leaf RNA as a template.

[0195] 2. Take 2 μl of PCR and connect it with the pMD18-T vector, and the operation steps are carried out according to the instructions of the product pMD18-TVector system of Promega Company. Then transform E. coli DH5α strain and grow overnight on LB plates coated with 5-bromo-4-chloro-3-indole-β-D-galactoside and X-gal containing ampicillin (100 μg / ml) . Pick white colonies and culture them overnight in LB liquid medium. Plasmid DNA was extracted by alkaline method and sequenced.

[0196] 3. The gene was excised from the pMD18-T vector with two restriction enzymes X...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the cloning, recombination and salt tolerance analysis of cotton Na+ / H+ reverse transport protein GhNHX1 gene, and belongs to the field of molecular biology and biological technology. Total RNA is extracted from cotton leaf treated with 0.4 mol / L NaCl solution and inversely transcribed into cDNA. Facultative primer is used for conventional PCR to obtain intermediate segment, and whole length cDNA is obtained through fast amplification in 3' and 5' ends. The gene is transformed to salt-sensitive yeast mutant to restore its salt tolerant capacity to some degree; and the gene is further transformed to tobacco to obtain transgenic plant capabl eof growing normally in salt concentration of 200 mmol / L. Therefore, the gene is one important salt tolerant gene and may be used in raising the salt tolerant capacity of plant for plantation in saline land.

Description

(1) Technical field [0001] The present invention relates to Na in cotton + / H + The cloning, recombination and salt tolerance function analysis and application of the antiporter gene GhNHX1 belong to the field of molecular biology and biotechnology. (2) Background technology [0002] High concentrations of salt cause ion imbalance and hyperosmotic stress in plants, resulting in poor plant development, slow growth and especially reduced crop yields. Severe salt stress or osmotic stress will cause the second stress in plants - oxidative stress, and even cause plant death. Therefore, people pay more and more attention to salt stress, and people pay more and more attention to improving the salt tolerance of crops. Under high salinity, plants mitigate the toxicity caused by salt stress by producing stress proteins and soluble osmoregulatory substances. Early salt-tolerant genetic engineering mainly focused on scavenging free radicals and increasing osmotic adjustment substanc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A01H1/00C07H21/00C07K14/415C12N15/29C12P19/34
Inventor郑成超吴长艾杨国栋
OwnerSHANDONG AGRICULTURAL UNIVERSITY