Check patentability & draft patents in minutes with Patsnap Eureka AI!

Nuclear male sterile plants, method of producing same and method to restore fertility

A male sterility, plant technology, applied in the fields of botanical equipment and methods, plant products, biochemical equipment and methods, etc., can solve the problem of the lack of further teaching on the properties of gene expression to be blocked

Inactive Publication Date: 2001-01-17
杰尼克莫根有限公司
View PDF25 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Apart from a general description of pro-meiotic genes and clearly mentioned clones, there is no further teaching on the nature of the expression of the genes to be blocked

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nuclear male sterile plants, method of producing same and method to restore fertility
  • Nuclear male sterile plants, method of producing same and method to restore fertility
  • Nuclear male sterile plants, method of producing same and method to restore fertility

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0089] Transformation of Tobacco, Lettuce and Arabidopsis

[0090] Transformation of lettuce (Lattuca sativa cv. Evola) was carried out according to the method of Curtis et al. ((1994) J. Exp. Bot., 45, 1441). Transformation of Arabidopsis thaliana was performed by the method described by Clarke et al. ((1992) Plant. Mo1. Bio1. Rep., 10, 178) or by the method described by Valvekens et al. (1988) Proceedings of the National Academy of Sciences of the United States (Proc. Natl. Acad. Sci. USA), 85, 5536).

[0091] In vitro shoots of tobacco (Micotiana tabacum) Samsun NN were grown on minimal MS20 medium (containing Murashige and Skoog basic salts and vitamins, 20 g sucrose, no hormones) for 4 weeks until they developed fully grown leaves. For in vitro shoots of Nicotiana Samsun NN were grown together with strains of Agrobacterium on minimal transformation medium stored at -80°C in 35% glycerol stock. Agrobacteria were grown on solid LLC medium containing RTK at 29°C for 3 days...

Embodiment 2

[0094] Example 2 Construction of plasmids pVDH403, pVDH417, pVDH512 (=pMOG1301) and pVDH517

[0095]The construction diagrams of pVDH403 and pVDH407 are shown in Figure 5 and Figure 6, respectively. The intermediate plasmids pVDH321 and pVDH318 in this scheme were constructed as described in PCT / EP97 / 02497. pVDH398 contains the Tap1 promoter described by Nacken et al. (Mol Genetics, 229, 129-136, 1991).

[0096] To construct pVDH512 (containing trehalose phosphohydrolase under the control of plastocyanin promoter, PC-TreC=pMOG1301), two oligonucleotide primers Tre-TreC-46 (forward-sense Primer) and Tre-TreC-47 (reverse primer containing BamHI site), the primer and Rimmele, M. and Boos, W. (1994, Trehalose-6-phosphate hydrolase from Escherichia coli, J. Bacteriology, 176. 5654-5664) describes complementation of the E. coli Tre C gene. Tre-TreC-46 5′CTCGGATCCGTAATGACTCATCTTCCCCAC 3′Tre-TreC-47 5′CTCGGATCCGATTTACTTCTGTAACCACC 3′

[0097] Similar to the construction of the PC...

Embodiment 3

[0100] Evaluation of Seed Production

[0101] Hat 1403 produced 20 independent transformants and Hat 1417 produced 5. These plants were transferred to the greenhouse and pollen viability was measured with 0.01% FDA (fluorescein diacetate) at anthesis (Fig. 7). Sterile plants were backcrossed with untransformed Samsum NN pollen to check if the transformants were only male sterile and not female sterile. After flowering, seed production was evaluated. Plants with very low self-pollination seeds were also harvested and reseeded to determine if the S1 seeds were viable. The scores are shown in Table 1. To analyze the correlation between the presence of the TPP gene and male sterility, the tap-TPP transgenic tobacco plant lines were backcrossed with wild-type plants according to the schematic diagram in Table 2. The offspring were analyzed for the presence of the TPP gene by phenotypic evaluation using PCR technology (Table 3).

[0102] Table 1. Phenotype of tobacco Samsum ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention is directed to the production of male sterile plants by providing them with a recombinant DNA capable of specific expression in the male reproductive system of a plant of the enzyme trehalose phosphate phosphatase (TPP). Restoration of the fertility can be established either by providing said male sterile plants with a recombinant DNA capable of expression of trehalose phosphate synthase (TPS) under control of an inducible promoter or with a recombinant DNA capable of expression of a suppressor protein which suppresses expression of TPP under control of an inducible promoter. This inducible restoration possibilities enable the maintenance site-specific recombination system is provided, by inserting two site-specific recombination sites flanking the recombinant DNA coding for TPP and crossing the male sterile lines with lines expressing the corresponding recombinase. By crossing the recombinase will excise the gene coding for TPP and fertile hybrids are produced.

Description

[0001] Field of invention [0002] The present application relates to methods of conferring nuclear male sterility in plants by transforming them with recombinant DNA, and restoring fertility in male sterile lines. Background of the invention [0003] It has long been recognized that cross-pollinated seeds from different parents of the same species can produce better yield, uniformity, environmental suitability, and disease resistance than progeny of self-pollinated seeds. Descendants of good traits. This effect is often referred to as the heterosis effect. To this end, one goal of the seed industry is to obtain hybrid seeds on as many agricultural and horticultural crops as possible because of their higher commercial value. [0004] The development of hybrid varieties of different plant species relies on the ability to achieve near-total cross-pollination between the parents. The simplest method is to confer male sterility in one of the parental lines by manually removing ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01H5/00C12N1/21C12N9/16C12N15/09C12N15/31C12N15/55C12N15/82C12N15/84
CPCC12N15/8289C12N15/8245C12N9/16C12N15/82
Inventor C·M·P·范邓恩O·J·M·古德迪恩
Owner 杰尼克莫根有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More