Method for using silkworm to express human interleukin 11 to produce medicine
An interleukin and drug technology, which is applied in biochemical equipment and methods, botanical equipment and methods, and drug combinations, etc., can solve the problem of high production costs, and achieve the effects of perfect processing, high expression efficiency and stable gene expression products.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0015]Primers were designed according to the published human interleukin-11 gene sequence (PNAS, 1990, VOL87, 7512), and XhoI and BamHI sites were designed at the 5 and 3 ends, respectively. The upstream primer is: 5'GGGCTCGAGATGCCTGGGCCACCACCTGGC3', and the downstream primer is: 5'GGGGATCCTCACAGCCGAGTCTTCAG3'. Take human bone marrow tissue cells, grind them at low temperature, add 1ml of Trizol RNA extraction solution produced by GIBCOBRL Company, shake gently for 10 minutes, and then add 500 μl of chloroform (Zhejiang Dier Pharmaceutical Co., Ltd.), placed at room temperature for 10 minutes, centrifuged at 12,000 rpm for 10 minutes, took the supernatant, added 2 times the volume of ethanol, mixed well, centrifuged at 12,000 rpm for 10 minutes, discarded the supernatant, and added reverse transcriptase 1000 Unit (GIBCOBRL) and 4dNTP (GIBCOBRL) were reverse transcribed at 37°C for 1 hour to obtain cDNA synthesized by reverse transcription of mRNA. Human interleukin-11 gene was...
Embodiment 2
[0016] The recombinant plasmid pUCIL-11 was double-digested with restriction endonucleases XhoI and BamHI to obtain the hIL-11 cDNA fragment added with the XhoI restriction site, which was inserted into the XhoI and XhoI of the transfer vector plasmid pBacPAK8 (CLONTECH Company) Between the two sites of Bgl II, the bacIL-11 transfer plasmid pBacIL-11 containing hIL-11 gene was constructed ( figure 1 ). Embodiment 3, the acquisition of the recombinant baculovirus of hIL-11 gene
Embodiment 3
[0017] Take 5ul insect baculovirus transfer plasmid pBacIL-11 containing human interleukin-11 gene and 6ul wild silkworm nuclear polyhedrosis virus DNA for co-transfection. Take 6ul Lipofectin (GIBCOBRL company) and add 100ul serum-free TC-100 medium and mix well. The BmN cells previously cultured in a 35mm Dish were washed twice with serum-free TC-100 (GIBCOBRL company) medium, and the transfer plasmid and Lipofectin mixture was added dropwise, cultured at 27°C for 4-5 days, and the supernatant was collected for the second stage. One round of plaque screening. Take 5ul of the supernatant to infect the BmN cells in a 35mm Dish, discard the supernatant after 1 hour and add an equal amount of mixed TC-100 medium and low melting point agarose. Pick plaques after 4-5 days, infect BmN cells for 3-4 days, save the supernatant, lyse the cells with NaOH for Southern hybridization, and take the supernatant of positive clones for 8 rounds of plaque screening and Southern hybridization ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com