Gene of earthworm plasmin and genetic engineerng strain, construction and application

A technology of genetically engineered strains and plasmin, applied in genetic engineering, application, plant gene improvement, etc., can solve the problems of inability to perform expression processing and modification, difficult expression, low expression level, etc., and achieve easy purification and stability Good, high expression effect

Inactive Publication Date: 2005-01-12
GREEN LIFE LAB
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Its biggest disadvantage is that it cannot perform post-expression processing and modification (such as glycosylation), which is necessary for many proteins to obtain function
[0009] CHO cell expression system: This is an expression system that is relatively difficult to construct and express at present. It is suitable for expressing glycosylated proteins and pro

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene of earthworm plasmin and genetic engineerng strain, construction and application
  • Gene of earthworm plasmin and genetic engineerng strain, construction and application
  • Gene of earthworm plasmin and genetic engineerng strain, construction and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0087] Embodiment 1. Gene PCR amplification and cloning of earthworm fibrinolytic enzyme

[0088] (1) Amplification primer synthesis

[0089] PCR oligonucleotide amplification primers were designed according to the published cDNA sequence of earthworm plasmin in GeneBank. The upstream primer is 18 nucleotides ACATGGAACTTCCTCCCG long, and the downstream primer is 19 nucleotides ATCACCAACAACTAAACCG long. Primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. and purified by PAGE.

[0090] (2) Earthworm total RNA extraction

[0091] Take 3 to 5 adult earthworms, rinse them with DEPC-treated sterilized water, put them on a flat plate covered with wet filter paper, and starve them overnight to make them spit out as much sediment as possible. After washing with DEPC water again, it was ground into powder in liquid nitrogen, and total RNA was extracted according to the product manual of QIAGEN's RNeasyRMini Kit. Store the extracted RNA solution at -80°C for future u...

Embodiment 2

[0109] Embodiment 2. Construction of Pichia pastoris genetic engineering strain expressing plasmin gene

[0110] (1) PCR amplification of earthworm fibrinolytic enzyme gene

[0111] Using the pUCm-T-EFE plasmid as a template, design primers based on the EFE mature peptide and the cloning site on the expression vector pPIC6αA, the upstream primer P1:C GAATTC CACCACCACCACCACCACGGTGGTGGTGACGACGACGACAAGATGGAACTTCCTCCCGGAACA (the site of the endonuclease EcoRI is underlined). Downstream primer P2:G TCTAGA TTAGTTGTTGGTGATGATGTCGGTGATCCATGCAGCAT (underlined endonuclease XbaI site). Primers were synthesized by Shanghai Sangon Bioengineering Company, and the synthetic products were purified by PAGE. The reaction components were: buffer 2.5 μl; 25mM MgCl2 1.5 μl; 10mM dNTP 2 μl; upstream primer 1 μl; downstream primer 1 μl; pUCm-T-EFE plasmid 1 μl; LA Taq DNA polymerase 2 μl; sterilized double distilled water 19 μl. The reaction parameters are: pre-denaturation at 95°C for 4 minute...

Embodiment 3

[0126] Embodiment 3. expression, separation, purification of genetically engineered plasmin protein;

[0127] (1) Fermentation process of Pichia pastoris engineering strain X-33 (pPIC6αA-EFE):

[0128] a. Pick a single bacterium of the recombinant bacterium and drop it into 20ml YPD liquid medium (1% yeast extract, 2% peptone, 2% glucose), and cultivate it at 30°C and 250rpm for activation;

[0129] b. After 16 hours, take 10ml of the activated bacterial solution and transfer it to 500ml of MGY liquid culture medium and culture it at 30°C and 250rpm to increase concentration;

[0130] c. After 24 hours of enrichment, the bacteria liquid was collected by centrifugation (1500g, 10 minutes, 4°C);

[0131] d. Resuspend the collected bacteria in 1000ml MM liquid medium to induce expression, and add methanol every 24h to a final concentration of 0.5%;

[0132] e. After 96 hours of induction, the supernatant of the fermentation broth was collected by centrifugation (30000g, 20 minu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

This invention discloses an earthworm plasminogen gene and gene engineering strain and its construction and its application, in which, the plasminogen gene is composed of 747 nuleotide, coding 246 amino acid, which gene expresses active gene engineering plasminogen protein, the fermented broth active unit surpasses 3, 390, 000U/L.

Description

technical field [0001] The present invention relates to a nucleotide sequence of the gene of the genus Pichia genus Pichia, and also relates to a preparation method of the gene, and also relates to the construction of a Pichia genetically engineered strain expressing the gene And the application of genetically engineered plasmin in drug research and development. Background technique [0002] Cardiovascular and cerebrovascular diseases such as acute myocardial infarction, cerebral infarction, pulmonary embolism, peripheral arterial thrombosis and deep venous thrombosis are one of the main diseases that endanger human life and health. According to the statistics of the World Health Organization, about 12 million people die of heart disease and stroke every year in the world. In my country, with the rapid economic development and the improvement of people's material living standards, the incidence and mortality of cardiovascular and cerebrovascular disea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K38/49A61P9/00C12N1/19C12N9/68C12N15/12C12N15/58C12N15/64C12N15/70C12Q1/68
Inventor 孟小林徐进平胡燕张俊杰鲁伟王健孟海洋
Owner GREEN LIFE LAB
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap