Gene of earthworm plasmin and genetic engineerng strain, construction and application
A technology of genetically engineered strains and plasmin, applied in genetic engineering, application, plant gene improvement, etc., can solve the problems of inability to perform expression processing and modification, difficult expression, low expression level, etc., and achieve easy purification and stability Good, high expression effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0087] Embodiment 1. Gene PCR amplification and cloning of earthworm fibrinolytic enzyme
[0088] (1) Amplification primer synthesis
[0089] PCR oligonucleotide amplification primers were designed according to the published cDNA sequence of earthworm plasmin in GeneBank. The upstream primer is 18 nucleotides ACATGGAACTTCCTCCCG long, and the downstream primer is 19 nucleotides ATCACCAACAACTAAACCG long. Primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. and purified by PAGE.
[0090] (2) Earthworm total RNA extraction
[0091] Take 3 to 5 adult earthworms, rinse them with DEPC-treated sterilized water, put them on a flat plate covered with wet filter paper, and starve them overnight to make them spit out as much sediment as possible. After washing with DEPC water again, it was ground into powder in liquid nitrogen, and total RNA was extracted according to the product manual of QIAGEN's RNeasyRMini Kit. Store the extracted RNA solution at -80°C for future u...
Embodiment 2
[0109] Embodiment 2. Construction of Pichia pastoris genetic engineering strain expressing plasmin gene
[0110] (1) PCR amplification of earthworm fibrinolytic enzyme gene
[0111] Using the pUCm-T-EFE plasmid as a template, design primers based on the EFE mature peptide and the cloning site on the expression vector pPIC6αA, the upstream primer P1:C GAATTC CACCACCACCACCACCACGGTGGTGGTGACGACGACGACAAGATGGAACTTCCTCCCGGAACA (the site of the endonuclease EcoRI is underlined). Downstream primer P2:G TCTAGA TTAGTTGTTGGTGATGATGTCGGTGATCCATGCAGCAT (underlined endonuclease XbaI site). Primers were synthesized by Shanghai Sangon Bioengineering Company, and the synthetic products were purified by PAGE. The reaction components were: buffer 2.5 μl; 25mM MgCl2 1.5 μl; 10mM dNTP 2 μl; upstream primer 1 μl; downstream primer 1 μl; pUCm-T-EFE plasmid 1 μl; LA Taq DNA polymerase 2 μl; sterilized double distilled water 19 μl. The reaction parameters are: pre-denaturation at 95°C for 4 minute...
Embodiment 3
[0126] Embodiment 3. expression, separation, purification of genetically engineered plasmin protein;
[0127] (1) Fermentation process of Pichia pastoris engineering strain X-33 (pPIC6αA-EFE):
[0128] a. Pick a single bacterium of the recombinant bacterium and drop it into 20ml YPD liquid medium (1% yeast extract, 2% peptone, 2% glucose), and cultivate it at 30°C and 250rpm for activation;
[0129] b. After 16 hours, take 10ml of the activated bacterial solution and transfer it to 500ml of MGY liquid culture medium and culture it at 30°C and 250rpm to increase concentration;
[0130] c. After 24 hours of enrichment, the bacteria liquid was collected by centrifugation (1500g, 10 minutes, 4°C);
[0131] d. Resuspend the collected bacteria in 1000ml MM liquid medium to induce expression, and add methanol every 24h to a final concentration of 0.5%;
[0132] e. After 96 hours of induction, the supernatant of the fermentation broth was collected by centrifugation (30000g, 20 minu...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap