High efficiency production method for recombinant silkworm antibacterial peptide CM4

A silkworm antimicrobial peptide and production method technology, applied in the field of genetic engineering, to achieve high expression efficiency, simple separation and purification, and good stability

Inactive Publication Date: 2005-08-17
NANJING NORMAL UNIVERSITY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are also reports at home and abroad using Pichia pastoris system to express antimicrobial peptides (Huang Yadong Antimicrobial Peptide AD Gene Transformation and Expression in Pichia South China University of Technology, 2002, 30(2), 13-16), but Pichia expression Systemic secretion and expression of silkworm antimicrobial peptide CM4, which has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High efficiency production method for recombinant silkworm antibacterial peptide CM4
  • High efficiency production method for recombinant silkworm antibacterial peptide CM4
  • High efficiency production method for recombinant silkworm antibacterial peptide CM4

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] (1) Construction of expression vector: According to the preferred codons of Pichia pastoris gene translation and the amino acid sequence of antimicrobial peptide CM4, and the multiple cloning site of pPIC9, two primers were designed and synthesized as follows:

[0029] ABP-F 5′agatggaagattttcaagaagatcgagaaggtcggtcaaaacatcagagacggtatcgt3′

[0030] ABP-R 5′aatagtagcagcttgaccgacgacagcgacagctggaccagccttgacgataccgtctc3′

[0031] The enzyme cutting sites are Xho I and Xba I, and the expression plasmid is pPICZaA. For vector construction, see figure 1 ;

[0032] (2) Construct genetically engineered bacteria: transform the host bacteria with the above-mentioned expression vector, and the host bacteria strain is yeast GS115;

[0033] (3) Induced expression: Use BMGY at 28°C to 30°C to ferment and cultivate the expression engineered bacteria for about 20 hours until the OD600 reaches 2-6; centrifuge, resuspend with BMMY until the OD600 is about 1.0, culture at 20°C to 30°C, eve...

Embodiment 2

[0036] Example 2: basically the same as Example 1, the difference is that during the process of inducing expression, 1-3% (W / V) acid hydrolyzed casein is added to BMMY to inhibit degradation. Analysis of the relationship between the amount of acid hydrolyzed casein and the expression product is as follows: figure 2 shown.

[0037] Adopt molecular sieve chromatography (separation medium is sephadex G50), equilibrate 5 column volumes (1.5×40cm) with 0.05M, pH5.1 ammonium acetate buffer solution, flow rate is 0.5ml / min; Above-mentioned sample loading; 0.05M, pH5 .1 Ammonium acetate buffer elution (0.15ml / min), chromatography and antibacterial activity analysis Figure 5 As shown, the eluate of antibacterially active protein was collected.

Embodiment 3

[0038] Embodiment 3: the same method as Example 2, analyze the relationship between methanol induction culture time and expression product as Figure 4 shown.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the expression and purification of recombinant protein in the field of gene engineering, and is especially the high efficiency production process of recombinant silkworm antibiotic peptide. Technologically, the high efficiency production process of recombinant silkworm antibiotic peptide includes the following steps: 1) constituting ABP-CM4 eukaryotic expression vector by means of DNA technology; 2) transforming host cell Pichia yeast with ABP-CM4 eukaryotic expression vector to constitute expression engineering bacteria; 3) fermentation culturing the engineering bacteria and performing methanol inducing expression; and 4) purifying expression product through chromatography with molecular sieve column to obtain recombinant silkworm antibiotic peptide CM4 product. The present invention has high expression efficiency, simple separation and purification and other advantages, and is suitable for industrial production.

Description

technical field [0001] The invention relates to the expression and purification of recombinant proteins in the field of genetic engineering, in particular to an efficient production method of recombinant silkworm antimicrobial peptide CM4. Background technique [0002] Antimicrobial peptides are molecular effectors of innate immunity and typically they contain 15-45 amino acid residues with a positive net charge. Cecropins-type cysteine-free linear peptides were the first to be discovered and derived from insects. More than 800 antimicrobial peptides and proteins have been found, originating from animals and plants. The main target of antimicrobial peptides is the membrane of bacteria, and the killing process must be faster than the growth rate of bacteria. It has been found that many traditional antibiotics, especially penicillin, can induce the production of drug-resistant strains. In order to solve the problem of antibiotic resistance, it is particularly important to d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K1/14C12N15/09C12N15/81C12P21/02
Inventor张双全张杰
OwnerNANJING NORMAL UNIVERSITY