Preparation with activities of laccase xylanase, peroxidase and its nucleolide series
A technology of peroxidase and nucleotide sequence, which is applied in the field of preparation of the above-mentioned preparations, can solve the problem that the degradation process of lignin is not comprehensive enough, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Cloning of laccase gene
[0039] 1. Construction of genomic library
[0040]Take the shake flask with vigorous mycelia growth, filter the mycelia with 4-6 layers of gauze, and air-dry the mycelia. Grind into fine powder in liquid nitrogen, transfer to a 50mL centrifuge tube in time, add 10-20mL extraction buffer (500mmol / L NaCl; 100mmol / L tris-HCl pH8; 50mmol / L EDTA pH8; 10mmol / L β-mercaptoethanol ), and swirl gently to mix. Add 1-3 mL of 20% SDS (pH 7.2), mix well, keep warm in a 65°C water bath for 20-30 minutes, and often mix gently. Add 5-10mL 5mol / L KAC, mix well and then ice-bath for 20-30 minutes. Centrifuge at 10,000 rpm at 4°C for 10 minutes. Take the supernatant, add an equal volume of chloroform / isoamyl alcohol (24:1), mix well, and centrifuge at 10,000 rpm at 4°C for 10 minutes. Take the water phase, accurately add 0.6-1 times the volume of isopropanol, mix gently, place on ice for 10 minutes, centrifuge at 7000rpm, 4°C for 10 minutes, wash th...
Embodiment 2
[0049] The expression of embodiment 2 laccase gene
[0050] The cloned ganoderma lucidum laccase full-length cDNA was cloned into the filamentous fungal expression vector to construct pBARGPE-Lac recombinant expression vector. The pBARGPE1 plasmid has a fungal promoter (Pgpd) and a terminator (TtrpC), and carries a bar gene that decomposes PPT. After pBARGPE1 is digested by EcoR I and Xho I, the digested product is recovered by gel electrophoresis. And ligated with the prepared full-length cDNA of Ganoderma lucidum laccase with EcoR I and Xho I cohesive ends overnight at 16°C. The ligation product was transformed into Escherichia coli competent cells, single clones were picked, and identified by enzyme digestion.
[0051] Preparation of Aspergillus protoplasts: Take vigorously growing spores, centrifuge them at 3000-5000 rpm for 5-10 minutes, remove the supernatant, and wash with 0.5-0.8mol / L osmotic pressure stabilizer (1M sorbitol) solution 1 to 3 times, add Novozyme prepa...
Embodiment 3
[0054] Example 3 Cloning of xylanase gene
[0055] Degenerate primers were designed with the known Bacillus pumilus xylanase homolog (P00694). A pair of primers were designed: primer 1: 5'GATGAATTCAEGAATTTGAGAAAATTAAG 3', primer 2: 5'GATGGATCCTTAGTTGCCAATAAACATCT 3', and its sequence was amplified by PCR and sequenced. The obtained sequence is shown in the sequence listing. The cleavage site of the xylanase gene was analyzed by DNASIS. Select a four-base enzyme with no enzyme cutting site in the xylanase gene, and use this enzyme to digest genomic DNA. After 5 μg of DNA was completely digested with restriction endonuclease, extracted once each with phenol and chloroform, precipitated with absolute ethanol, and dissolved in 20 μl. sterile deionized water. Measure OD260 and OD280 to determine the purity and content of DNA. About 200ng of digested total DNA was taken for self-circularization ligation reaction. The total DNA concentration in the system is about 20ng / μl; T 4 ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Capacitance | aaaaa | aaaaa |
| Resistance | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



