Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation with activities of laccase xylanase, peroxidase and its nucleolide series

A technology of peroxidase and nucleotide sequence, which is applied in the field of preparation of the above-mentioned preparations, can solve the problem that the degradation process of lignin is not comprehensive enough, etc.

Inactive Publication Date: 2005-08-24
李宝健 +1
View PDF0 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The lignin degradation process proposed above is still not comprehensive enough, and it is necessary to further study and find out the types and chemical reaction characteristics of lignin free radicals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation with activities of laccase xylanase, peroxidase and its nucleolide series
  • Preparation with activities of laccase xylanase, peroxidase and its nucleolide series
  • Preparation with activities of laccase xylanase, peroxidase and its nucleolide series

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Cloning of laccase gene

[0039] 1. Construction of genomic library

[0040]Take the shake flask with vigorous mycelia growth, filter the mycelia with 4-6 layers of gauze, and air-dry the mycelia. Grind into fine powder in liquid nitrogen, transfer to a 50mL centrifuge tube in time, add 10-20mL extraction buffer (500mmol / L NaCl; 100mmol / L tris-HCl pH8; 50mmol / L EDTA pH8; 10mmol / L β-mercaptoethanol ), and swirl gently to mix. Add 1-3 mL of 20% SDS (pH 7.2), mix well, keep warm in a 65°C water bath for 20-30 minutes, and often mix gently. Add 5-10mL 5mol / L KAC, mix well and then ice-bath for 20-30 minutes. Centrifuge at 10,000 rpm at 4°C for 10 minutes. Take the supernatant, add an equal volume of chloroform / isoamyl alcohol (24:1), mix well, and centrifuge at 10,000 rpm at 4°C for 10 minutes. Take the water phase, accurately add 0.6-1 times the volume of isopropanol, mix gently, place on ice for 10 minutes, centrifuge at 7000rpm, 4°C for 10 minutes, wash th...

Embodiment 2

[0049] The expression of embodiment 2 laccase gene

[0050] The cloned ganoderma lucidum laccase full-length cDNA was cloned into the filamentous fungal expression vector to construct pBARGPE-Lac recombinant expression vector. The pBARGPE1 plasmid has a fungal promoter (Pgpd) and a terminator (TtrpC), and carries a bar gene that decomposes PPT. After pBARGPE1 is digested by EcoR I and Xho I, the digested product is recovered by gel electrophoresis. And ligated with the prepared full-length cDNA of Ganoderma lucidum laccase with EcoR I and Xho I cohesive ends overnight at 16°C. The ligation product was transformed into Escherichia coli competent cells, single clones were picked, and identified by enzyme digestion.

[0051] Preparation of Aspergillus protoplasts: Take vigorously growing spores, centrifuge them at 3000-5000 rpm for 5-10 minutes, remove the supernatant, and wash with 0.5-0.8mol / L osmotic pressure stabilizer (1M sorbitol) solution 1 to 3 times, add Novozyme prepa...

Embodiment 3

[0054] Example 3 Cloning of xylanase gene

[0055] Degenerate primers were designed with the known Bacillus pumilus xylanase homolog (P00694). A pair of primers were designed: primer 1: 5'GATGAATTCAEGAATTTGAGAAAATTAAG 3', primer 2: 5'GATGGATCCTTAGTTGCCAATAAACATCT 3', and its sequence was amplified by PCR and sequenced. The obtained sequence is shown in the sequence listing. The cleavage site of the xylanase gene was analyzed by DNASIS. Select a four-base enzyme with no enzyme cutting site in the xylanase gene, and use this enzyme to digest genomic DNA. After 5 μg of DNA was completely digested with restriction endonuclease, extracted once each with phenol and chloroform, precipitated with absolute ethanol, and dissolved in 20 μl. sterile deionized water. Measure OD260 and OD280 to determine the purity and content of DNA. About 200ng of digested total DNA was taken for self-circularization ligation reaction. The total DNA concentration in the system is about 20ng / μl; T 4 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Capacitanceaaaaaaaaaa
Resistanceaaaaaaaaaa
Login to View More

Abstract

A preparation with the activities of laccase, xylanase and peroxidase for paper-making, environment production, food and feed industries is prepared through cloning new genes of laccase, xylanase and peroxidase, configuring their expression carrier, introducing it to yeast or mycelial fungus for expression, checking the activity of recombinant enzymes, and mixing said recombinent enzymes together.

Description

technical field [0001] The present invention relates to a preparation with laccase, xylanase and peroxidase activities and its nucleotide sequence, and also relates to the preparation method and application of the above preparation. Background technique [0002] Green plants account for 95% of the earth's terrestrial biomass, and their chemical substances are mainly lignin, cellulose and hemicellulose, which account for 15% to 20%, 45% and 20% of the dry weight of plants, respectively. However, it is quite difficult to fully and effectively utilize such resources because the water-insoluble lignocellulose is difficult to be hydrolyzed by acids and enzymes. Lignin and hemicellulose are combined in the form of covalent bonds to embed cellulose molecules in it, forming a natural barrier that makes it difficult for enzymes to contact cellulose molecules. , leading to the refractory degradation of lignocellulose. Therefore, in order to utilize or completely degrade cellulose, t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N9/08C12N9/24C12N9/42C12N15/63
Inventor 李宝健程度
Owner 李宝健
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com