4-ketocarotenoids in flower petals

A carotene and petal technology, applied in angiosperms/flowering plants, biochemical equipment and methods, fermentation, etc., can solve the problems of not giving carotenoid yield, not giving total carotenoids, etc.

Inactive Publication Date: 2006-01-04
BALL HORTICULTURAL
View PDF26 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, no evidence is given as to the amount of initial carotenoids present in the flower, nor the amount of total carotenoids actually produced, nor carotenoids in the petals and reproductive parts of the flower output

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 4-ketocarotenoids in flower petals
  • 4-ketocarotenoids in flower petals
  • 4-ketocarotenoids in flower petals

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0264] Embodiment 1: Construction of β-carotene ketolase (β-carotene oxygenase) expression vector

[0265] A. β-carotene ketolase from Haematococcus pluvialis

[0266] Utilizing the gene clone obtained by Dr. Toshihiro Toguri, Kirin Brewery Co., Ltd as a template, the β-carotene ketolase gene (crtW) from Haematococcus pluvialis was prepared by polymerase chain reaction (PCR) [see Kajiwara et al., Plant Mol Biol., 29(2):343-352 (1995)]. Use specific primers to introduce a Kpn I restriction enzyme site (crtW-L28: GCCAGTGCCAA GGTACCCTTGTCATGCC; SEQ ID NO: 1) at the 3' end of the gene, and an Nde I site (crtW-U28: CCGGGGATCCTCTACATATGCACGTCGC; SEQ ID NO: 1) at the 5' end. ID NO: 2). After digestion with KpnI and NdeI, the crtW gene was ligated into the plasmid pBHX533 containing the nopaline synthase polyadenylation signal ( figure 2 )middle. The resulting vector was named pBHX539 ( image 3 ).

[0267] Sources were prepared by PCR using primers introducing an Xma I sit...

Embodiment 2

[0286] Example 2: Binary Vectors

[0287] Plasmid pBHX103

[0288] The plasmid containing the 5' flanking region of the fairy fan LIS1 gene was obtained from Dr. Eran Pichersky, University of Michigan. An approximately 1 kb fragment containing the LIS1 5' flanking region was synthesized by PCR using primers: BHX30: CCAAGCTTATCTAATAATGTATCAAAATC (SEQ ID NO: 11) and BHX36: CAGCCC GGGATGGTTGTCTTGTTTAAGGTGG (SEQ ID NO: 12). These primers were designed to anneal to the 5' flanking region at one end and the 5' untranslated leader at the 3' end. The PCR product was digested with restriction enzymes Hind III and Sma I that cut at the 5' and 3' ends of the fragment, respectively. The digested fragment was gel purified and subsequently inserted into a Hind III and Sma I digested plasmid containing the multiple cloning site region (MCS) followed by the nos polyA signal region to generate the LIS1::MCS::nos transgene (Designated as plasmid pBHX103).

[0289] Plasmid pBHX107

[0290...

Embodiment 3

[0328] Example 3: EMS Treatment of Marigold 'Scarletade'

[0329] Marigold carotene marigold (from PanAmerican Seed Co. 622 Town Road, West Chicago) designated 'Scarletade' was treated with ethyl methanesulfonate (EMS, commercially available from Sigma Chemical Co., St. Louis, MO 63178). , IL 60185 commercially available) seeds. Approximately 2,500 seeds were added to 400 ml of 0.4% (v / v) or 0.8% (v / v) EMS and stirred gently at room temperature for 8 hours. During the 4 hours after EMS treatment, the seeds were washed 16 times with 400 ml of distilled water each time with continuous agitation. Then the processed seed is defined as M 1 Seeds, sown in trays containing soilless ceramic mix.

[0330] After a few weeks, the seedlings are transplanted into pots containing a soilless ceramic mix and grown in a greenhouse. The flowers produced by these plants are naturally self-pollinating. The resulting seeds were harvested from approximately 2,300 plants, defined as M 2 seed...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Discloses the formation of carotenoid compounds containing 4-keto-β-ionene rings such as astaxanthin or canthaxanthin in higher plant flowers, and particularly in the corolla and reproductive parts of higher plant flowers, wherein said Petals of higher plants produce carotenoid compounds containing β-ionene rings such as β-carotene or zeaxanthin, but otherwise do not produce astaxanthin or canthaxanthin. One or more genes regulated by a promoter are inserted (transformed) into higher plants. The inserted gene encodes a chimeric enzyme comprising (a) a carotenoid-forming enzyme that is at least a ketolase. The gene is operably linked to (b) a plastid-directed transit peptide. Some of the higher plants to be transformed produce at least zeaxanthin or beta-carotene in their pre-transformation flowers, while other plants produce only minimal, if any, colored carotenoid pigments prior to transformation, and use carotenoid Gene forming cassettes for transformation. Transformation methods and uses of transformed plants are described.

Description

[0001] Cross-references to related applications [0002] This application is a continuation-in-part of Application Serial No. 10 / 325,265, filed December 19, 2002, which claims priority over U.S. Provisional Application Serial No. 60 / 366,444, filed March 21, 2002 right. field of invention [0003] The present invention relates to carotenoid biosynthesis and biotechnological production of astaxanthin. More specifically, the present invention relates to a gene that is preferentially expressed in flowers, and particularly in corollas and reproductive parts of flowers such as petals, which encodes an enzyme that converts Carotenoid compounds with rocene rings, such as β-carotene, are converted to carotenoid compounds containing 4-keto-β-ionene rings, so that petals accumulate carotenoids containing 4-keto-β-ionene rings prime compounds. Background technique [0004] Carotenoids are natural pigments associated with many of the yellows, oranges and reds seen in living organisms....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01H1/06A01H5/00A01H5/02C12N15/00C12N15/82
InventorR·豪普特曼R·埃森赖希W·埃申费尔特Z·坎姆巴塔
OwnerBALL HORTICULTURAL